Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • morning latte
    Member
    • Jun 2013
    • 91

    removing adapter sequences

    Hello,

    I am working with Illumina Hiseq data (100-bp PE). I am trying to remove adapter sequences using Trimmomatic. I've got adapter sequences from the sequencing core I used. But some of adapter sequences still remain after running Trimmomatic when I checked them using FastQC. Any suggestions would be great. Thanks.
  • jimmybee
    Senior Member
    • Sep 2010
    • 119

    #2
    Can you give us an example of what you ran and what you're getting as an output? We can't really help you unless we get some background....

    Comment

    • ahnguyen
      Junior Member
      • Nov 2013
      • 1

      #3
      I am having essentially the same problem originally psoted above. I want to remove adapter sequences from Illumina 100 bp PE reads. I run the following with Trimmomatic:

      java -classpath ~/Scripts/Trimmomatic-0.30/trimmomatic-0.30.jar org.usadellab.trimmomatic.TrimmomaticPE -phred33 -trimlog trim_2.log R1.fastq R2.fastq T1.fastq T1.unpaired.fastq T2.fastq T2.unpaired.fastq ILLUMINACLIP:adapters.fa:3:40:15 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:15

      My adapters.fa file includes the following (in addition to others):
      >DNA_primers_1
      AGGGAGGACGATGCGG
      >DNA_primers_2
      CCGCTGGAAGTGACTGACAC
      >RNA_linkers_2
      GTGTCAGTCACTTCCAGCGG

      I ran FastQC prior to trimming the adapters and the over-represented sequences include
      Sequence Count Percentage
      CCGCTGGAAGTGAC... 115468 0.44
      AGGGAGGACGATGC... 112267 0.427
      CCGCTGGAAGTGAC... 109341 0.416
      AGGGAGGACGATGC... 105312 0.401
      CCGCTGGAAGTGAC... etc etc
      CCGCTGGAAGTGAC...

      After running Trimmomatic, run FastQC on the new fastq's and get the following for overrpresented sequences:
      Sequence Count Percentage
      CCGCTGGAAGTGAC... 109151 0.426
      AGGGAGGACGATGC... 106128 0.414
      CCGCTGGAAGTGAC... 102985 0.402
      AGGGAGGACGATGC... 99644 0.389
      CCGCTGGAAGTGAC... etc etc
      CCGCTGGAAGTGAC...

      Is this not surprising? I think a lot of the remaining adapter sequences are adapters linked to each other, so they are well represented in the first 10 bps.

      - Andrew

      Comment

      • mastal
        Senior Member
        • Mar 2009
        • 666

        #4
        Hi Andrew (ahnguyen),

        I think the adapter sequences you are using (for example the 16 bp DNA_primers_1 and the 20 bp DNA_primers_2) are not long enough for Trimmomatic to recognise a match, given the thresholds you are using
        (3:40:15, so 40 for palindrome clipping and 15 for simple clipping).

        If you look at the Trimmomatic web page,



        on the last paragraph of the section titled 'The Adapter Fasta', it explains that
        'Each matching base adds just over 0.6' to the score, so even if your read matches the adapter sequence perfectly, it would score only 20 X 0.6 = 12.
        You have set the threshold for simple clipping to 15, a score which none of your reads will reach, so trimmomatic will not recognize any of the reads as having the adapter sequence you want to trim.

        Comment

        • arcolombo698
          Senior Member
          • Nov 2013
          • 142

          #5
          how do you create the adapters.fa file?
          I have the same problem

          Comment

          • mastal
            Senior Member
            • Mar 2009
            • 666

            #6
            The more recent versions of Trimmomatic include adapters.fa files for Illumina Truseq v2 and v3.

            See the link to the Trimmomatic web page that I gave in the post above if you don't already have Trimmomatic installed on your computer.

            Have a look at that, and then if you want to use other adapter sequences you can either add them to the file, or make your own file.

            Comment

            Latest Articles

            Collapse

            • SEQadmin2
              Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
              by SEQadmin2



              Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
              ...
              07-09-2026, 11:10 AM
            • SEQadmin2
              Cancer Drug Resistance: The Lingering Barrier to Rising Survival
              by SEQadmin2



              Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

              There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
              07-08-2026, 05:17 AM
            • GATTACAT
              Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
              by GATTACAT
              Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
              07-01-2026, 11:43 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, 07-13-2026, 10:26 AM
            0 responses
            18 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-09-2026, 10:04 AM
            0 responses
            30 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-08-2026, 10:08 AM
            0 responses
            16 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-07-2026, 11:05 AM
            0 responses
            34 views
            0 reactions
            Last Post SEQadmin2  
            Working...