Paired end or not ?

[sowmyai]

Hi

I am very new to sequencing and bioinformatics in general. I have been tasked with de novo sequencing of many short reads of a microbe. I thought I'd start out with Velvet. Just by looking at the input, I am not able to make out if they are paired end reads or not, or what format they are (fasta, eland etc).
My file looks like this: Many lines of 35-long nucleotides with a number after each (anywhere between 1 and 65 I think these are the number of repeated reads).

Could someone help me with the input format - is it paired end ? fasta ? What is this ?

Thanks

[Bardj]

It may be beneficial if you could paste a segment of the file you are looking at. I know for me it helps to see a visual, so I can compare to other files that I have.

[sowmyai]

Attttttttttttctttttttttatctatttatttt 1
aggctggaagctgccttcaacttgagatcggaagag 1
aaagtgtgcggagcgcccccttgtgtcatcggaggg 65
tccagttacaacctaaccaattgcccagcggtggcc 2