Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • vcf-consensus for individuals from 1000G

    Hi,

    I would like to create consensus sequence for an individual from 1000G where the sequence incorporates variants typed for this individual.

    Using tabix and vcf-tools (vcf-subset), I extracted the relevant variant information from 1000G SNP call files.

    At this point, I have variants per chromosome for individual HG000096.

    I would like to incorporate these variants into reference coding sequence.

    I downloaded all protein-coding sequences for the GRCh37 version from Ensembl Biomart.

    An example with trimmed sequence looks like this:

    Code:
    >ENSG00000003137|ENST00000001146|ENSP00000001146|2|72356367|72375167
    ATGCTCTTTGAGGGCTTGGATCTGGTGTCGGCGCTGGCCACCCTCGCCGCGTGCCTGGTG
    TCCGTGACGCTGCTGCTGGCCGTGTCGCAGCAGCTGTGGCAGCTGCGCTGGGCCGCCACT
    CGCGACAAGAGCTGCAAGCTGCCCATCCCCAAGGGATCCATGGGCTTCCCGCTCATCGGA
    Note: typical fasta sequence file with the header including gene|transcript|protein|chr|chr_start|chr_end

    My understanding is that there are a few alternatives out there to produce consensus sequences given a reference fasta sequence and variant call file: (1) AlternativeReferenceMaker, (2) vcf-consensus, (3) mpileup.

    I would like to use vcf-consensus for my task.

    vcftools describes the use of vcf-consensus as follows:

    Code:
    cat ref.fa | vcf-consensus file.vcf.gz > out.fa
    I presume that the reference file here refers to the reference DNA sequence including coding and non-coding parts of the genome. In that case, my protein-coding sequence above would not work as an acceptable reference sequence. Nevertheless, I am only interested in the protein-coding part.

    How can I modify vcf-consensus or my input sequences to create consensus coding sequence for HG00096 given the reference coding sequence and his variants?

    Thank you very much.

    As soon as I figure out a way to get this done, I will have a follow-up question concerning the diploidy, that is, how can I tell whether a variant is called at a heterozygous site or not.

  • #2
    cross posted on biostars: http://www.biostars.org/p/85681/

    Comment


    • #3
      cross posted on biostars: http://www.biostars.org/p/85681/
      Yes! Thank you for the link.

      Comment


      • #4
        Can anybody help to figure out this problem?

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Best Practices for Single-Cell Sequencing Analysis
          by seqadmin



          While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
          06-06-2024, 07:15 AM
        • seqadmin
          Latest Developments in Precision Medicine
          by seqadmin



          Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

          Somatic Genomics
          “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
          05-24-2024, 01:16 PM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, Yesterday, 07:23 AM
        0 responses
        8 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 06-17-2024, 06:54 AM
        0 responses
        12 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 06-14-2024, 07:24 AM
        0 responses
        24 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 06-13-2024, 08:58 AM
        0 responses
        18 views
        0 likes
        Last Post seqadmin  
        Working...
        X