[alig]

fq_all2std

Hi,

the "std2qual" is part of the perl script "fq_all2std.pl" which comes with maq-0.7.1

thanks

ali

[cgkumar]

To lparsons,

Thank you. Yes I realised that later after I'd sent my post.

Also in case anyone else is looking to separate a fastq file into seq.fasta & qual.fasta files you actually need the other command within Maq

fq_all2std.pl std2qual <out.prefix> <in.fastq>

Thanks again

alig

Hi,

I need to convert Illumina files into .seq and .qual for Phrap. I am unable to find the newest version of "fq_all2std.pl" with the "std2qual". Is there any other program that would convert the Illumina quality characters into phred qualities?

Thanks,
Charu

[vschulz]

The awk line only outputs sequences with Y in the 12th (QC??) field. If you want all sequences in fastq output, you can do

awk ' {print "@"$1"_000"$2":"$3":"$4":"$5":"$6"#"$7"/"$8"\n"$9"\n+"$1"_000"$2":"$3":"$4":"$5":"$6"# "$7"/"$8"\n"$10}' s_1_export.txt > s_1_sequence.txt

caveats that I don't know awk , but output seems correct.

[husamia]

If you are working in LINUX, you can use awk as follows:

awk '$12 ~ /Y/{print "@"$1"_000"$2":"$3":"$4":"$5":"$6"#"$7"/"$8"\n"$9"\n+"$1"_000"$2":"$3":"$4":"$5":"$6"#"$7"/"$8"\n"$10}' s_1_export.txt > s_1_sequence.txt

just to clarify, is this to convert the format SCARF ASCII mentioned above? is there any quality trimming done? because I got a file that was smaller than what I expected. I started out with file that has 43,236,910 reads to a file that has 80,81,040 lines. here is sample of input to I take it same as above post
HWI-EAS393 0031 5 1 1295 9710 0 3 AGACGTGTGTCTGAGTAAGGAACCCGCGGGGAAGGG ]PLLPU\]Z_`^`L`aL^`LYb^bbc`^^cH``TL^ c10.fa 130687332 F 3A26T3T1 70 188 128 R Y

[Asifullah]

Hi

I'm trying to work through some of the various assembler programs before actually collecting my own Illumina data. I've found some test datasets here:

http://sharcgs.molgen.mpg.de/download.shtml

but I'm not sure if the file formats are the same as raw data from the Genome Analzyer.

The files are s_4_seq.txt and s_4_prb.txt and the first few lines look like this:
s_4_seq.txt
4 1 56 910 AACTTACAATTGAAAATATAAACTCAT
4 1 64 716 AAGATGATTATATGTCTTCCTTTTCGA
4 1 890 894 TCAAACCAATCAGACCTATGTTTCATA

s_4_prb.txt
40 -40 -40 -40 40 -40 -40 -40 -40 40 -40 -40 -40 -4
0 -40 40 -40 -40 -40 40 40 -40 -40 -40 -40 40 -40
-40 40 -40 -40 -40 40 -40 -40 -40 -40 -40 -40 40

So my questions are
1. Is this the raw data format from the machine?
2. How do I get these files into fastq format? The maq converter and sanger perl scripts previously mentioned do not seem to work.

Thank you!

Hi,

I my self facing the same format within my illumina sequencing file which you have shown here. could you please provide me any perl script for converting such data in to fasta or fastq format. i will be highly oblige to find any guidelines from your side. my email address for corresponding is (asifullah111"gmail.com).

regards
asif

[Asifullah]

Dear All,
I am anew user and i am analyzing Illumina NGS data. I downloaded the bowtie on Linux on 32 bit Linux system for reference based assembly. I sucessfully follow its tutorial for aligning an exemplary data already given within software folder. But I am stuck at Samtool step of aligning visualization. could some one please help me beyond that step. I thing i can,t compiled accurately the Samtool. could you please provide ready to run compiled version of samtool for 32 bit Suse linx system. I will higly oblige. my email address for corresponding is ([email protected]).
Thanks all and sorry if my question is too silly as i am a new user of bowite.

Asif

[vjimenez]

If you are working in LINUX, you can use awk as follows:

awk '$12 ~ /Y/{print "@"$1"_000"$2":"$3":"$4":"$5":"$6"#"$7"/"$8"\n"$9"\n+"$1"_000"$2":"$3":"$4":"$5":"$6"#"$7"/"$8"\n"$10}' s_1_export.txt > s_1_sequence.txt

[[email protected]]

@hannat..

Did you get the solution of your problem. I have same kind of problem with my data.

Thanks

[federica torri]

script format converter

To lparsons,

Thank you. Yes I realised that later after I'd sent my post.

Also in case anyone else is looking to separate a fastq file into seq.fasta & qual.fasta files you actually need the other command within Maq

fq_all2std.pl std2qual <out.prefix> <in.fastq>

Thanks again

alig

Hi,

I checked in my maq 0.7.1 version for this script but I didn't find it...do you know if it is anymore available or did you find it as a supplemetary maq script? Thanks

[lhw_genome]

hi,
everyone, I am a new user of BWA. Greatly appreciate if I could get any of your help!
I have paired-end Solexa data (in two files s_2_1.export.txt ; s_2_2_export.txt) presented in the following format (SCARF ASCII with mapping information)

HWI-EAS433 16 3 11 255 71 0 2 TGAAAGGGAATATCTTCATATAAAATCTAGACAAAAGCATTCTCAGAATC abbb``b_`aaab_bb``babaa_`a^b_a__aaa`aa`aa`_`aa[^a_
chr9.fa 66572916 F G32G3A10G1 33 0 chr7.fa 61087451 R Y

now, I would like to convert the Solexa export file to fastq format file so that I could use BWA, I tried the scripts fq_all2std.pl export2std command, but it doesn't work. i also tried scarf2std command, it converted my file, but the export file was not the fastq format, there was other information (Eland mapping position also included in the output file.

I don't have any experience to write perl or other scripts.
Could you please help me?
Many thanks!

[der_eiskern]

Oh yeah! We have. And that is the best that I've come across in my career for alignment of short reads. Just too fast - Great for expression data.

Spade

I heard bowtie is great for mapping Chromatin IPs and RNA back to a reference but isn't as good as MAQ for finding snps though. Is this accurate?

[spadejac]

Bowtie for alignment

Has anybody used Bowtie for mapping?

Oh yeah! We have. And that is the best that I've come across in my career for alignment of short reads. Just too fast - Great for expression data.

Spade

[[email protected]]

Bowtie

Has anybody used Bowtie for mapping?

[alig]

convert fastq to fasta

To lparsons,

Thank you. Yes I realised that later after I'd sent my post.

Also in case anyone else is looking to separate a fastq file into seq.fasta & qual.fasta files you actually need the other command within Maq

fq_all2std.pl std2qual <out.prefix> <in.fastq>

Thanks again

alig

[lparsons]

You simply need to redirect the standard output (which is printing to your screen) to a file:

fq_all2std.pl fq2fa in.txt > out.fasta

See http://www.december.com/unix/tutor/redirect.html for more info.