Errors: Mapped mate should have mate reference name and MAPQ should be 0 for unmappe

[rosales]

Hi,

I want to convert my bam file (from tophat) to a fasta file. First, I used samtools view to convert sam to bam and then I used picard's SamToFastq to convert to fastq, but I received the following error:

Exception in thread "main" net.sf.samtools.SAMFormatException: Error parsing text SAM file. MAPQ must be zero if RNAME is not specified; Line 1
Line: DB775P1:275:C27JRACXX:1:2307:16302:100526 133 * 0 255 * * 0 0 CGGAAACCTTGTTACGACTTTTACTTCCTCTAGATAGTCAAGTTCGACCGTCTTCTCAGCGCTCCGCCAGGGCCGTGGGCCGACCCCGGCGGGGCCGATCC CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJJJIJJJJJJIJJJJJJJJJJJIJJHHFFFDDDDDDDDDDDDDCDDDDDDDDDDDDDDDDDDDD?


Here is the command I ran:
java -jar picard-tools-1.103/SamToFastq.jar INPUT=unmapped1.sam FASTQ=tophat_1914_unmapped_R1.fq SECOND_END_FASTQ=tophat_1914_unmapped_R2.fq


Also I used Picards ValidateSamFile program to check my samfile and the output is as follows:
ERROR: Record 1, Read name DB775P1:275:C27JRACXX:1:1101:1661:1847, Mapped mate should have mate reference name
ERROR: Record 1, Read name DB775P1:275:C27JRACXX:1:1101:1661:1847, MAPQ should be 0 for unmapped read.

Does anyone know how to fix this problem or another way to convert bam to fastq or fasta.

I used the below command to convert bam to fasta, but it looks like I loose the pair-end data information.
samtools view unmapped.bam | awk '{OFS="\t"; print ">"$1"\n"$10}' - > unmapped.fasta

So I need something that takes into consideration that I have pair-end data.

Thanks

[swbarnes2]

Well, Picard is complaining because your .bam is weird. There's no indication of what the mate is named, and there's no information about how it aligned in the binary flag either. That's weird.

You could try running Picard with VALIDATION_STRINGENCY=LENIENT, but maybe you should figure out why your .bams are so weird. Maybe the mate got trimmed away by some kind of QC? In which case, the remaining read should have been treated like a single end read, not a paired one.

[rosales]

Using VALIDATION_STRINGENCY=LENIENT did the trick. I was able to convert sam to fastq.
THANKS!!!!!!!