Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • counting total bases in a fasta file

    Hello,

    I have a fasta file like below.

    >NODE_1476_length_303_cov_5.280528
    TTAAGTGGGATTTCGTTTAGTGAGGTAGGTACTTTTACTTGGATTTCCATAATTGTATAAG
    TCTTTTAGTCGTTTTTGTATTCCTTAGCCAATACATAAGAGTAGGCTTGAGCTAACATTTGA......
    >NODE_2306_length_339_cov_2.926254
    .
    .
    .

    I want to get total base-pair count from this file. I tried fastx toolkit but it did not work as my fasta format is not what fastx wants (guess fastx wants one line of sequences while mine has two lines of sequences). Could somebody suggest any tool or command for it? Thanks.

  • #2
    Here's a quick unix hack:
    grep -v ">" file.fasta | wc | awk '{print $3-$1}'

    Comment


    • #3
      Thanks, it works very well.

      Comment


      • #4
        The number of contigs

        I am given a fasta file like this file that you can download it. This file is de novo assembled genome.

        I have two very simple questions:

        1- How many contigs are present in this file? (my guess: it is equal to the number of rows in the file?!)

        2- what is the total genomic length of the assembly?
        (my guess: it is 'len=245876' which has been written in the first line)

        I am new in DNA sequence analysis stuff, thanks for your kind help.

        Comment


        • #5
          Originally posted by na_sd View Post
          The number of contigs

          I am given a fasta file like this file that you can download it. This file is de novo assembled genome.

          I have two very simple questions:

          1- How many contigs are present in this file? (my guess: it is equal to the number of rows in the file?!)
          @Brian and I had answered some of these questions in your Biostars post but looks like you are not convinced. The answers are still going to be the same.

          If you do
          Code:
          grep -c "^>" your_file
          that will give you a number for the contigs present in your file.
          2- what is the total genomic length of the assembly?
          (my guess: it is 'len=245876' which has been written in the first line)

          I am new in DNA sequence analysis stuff, thanks for your kind help.
          That may just be the length of first contig. Does each of your contigs have such a number? We don't know if the contigs you have overlap so it may not be possible to answer this question directly.

          PS: I am not going to download the file from dropbox to test.

          Comment


          • #6
            Originally posted by GenoMax View Post
            @Brian and I had answered some of these questions in your Biostars post but looks like you are not convinced. The answers are still going to be the same.

            If you do
            Code:
            grep -c "^>" your_file
            that will give you a number for the contigs present in your file.


            That may just be the length of first contig. Does each of your contigs have such a number? We don't know if the contigs you have overlap so it may not be possible to answer this question directly.

            PS: I am not going to download the file from dropbox to test.

            Thanks.
            I am not convinced because my file is not like general fasta file. It has ONLY one line with '>'. The person has asked me about the number of contigs in this file and I am sure that it is greater than 1.
            I wish you had downloaded the file and then answered my question.

            Comment


            • #7
              Originally posted by na_sd View Post
              Thanks.
              I am not convinced because my file is not like general fasta file. It has ONLY one line with '>'. The person has asked me about the number of contigs in this file and I am sure that it is greater than 1.
              I wish you had downloaded the file and then answered my question.
              If there is only one line starting with ">" in your file then

              a> Your file is either incomplete or
              b> the sequence got assembled as a single contig

              note: You appear to have removed the file from dropbox.
              Last edited by GenoMax; 09-23-2016, 06:23 AM.

              Comment

              Latest Articles

              Collapse

              • seqadmin
                Current Approaches to Protein Sequencing
                by seqadmin


                Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
                04-04-2024, 04:25 PM
              • seqadmin
                Strategies for Sequencing Challenging Samples
                by seqadmin


                Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
                03-22-2024, 06:39 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by seqadmin, 04-11-2024, 12:08 PM
              0 responses
              24 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 04-10-2024, 10:19 PM
              0 responses
              25 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 04-10-2024, 09:21 AM
              0 responses
              21 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 04-04-2024, 09:00 AM
              0 responses
              52 views
              0 likes
              Last Post seqadmin  
              Working...
              X