Seqanswers Leaderboard Ad



No announcement yet.
  • Filter
  • Time
  • Show
Clear All
new posts

  • duplicate tags tophat2

    I am using tophat2 (2.0.10) with bowtie2 to map Illumina HiSeq 2000 2x100 paired-end RNA sequencing data to the human genome/transcriptome.

    Examinations of the tophat-generated 'accepted_hits.bam' files, for both stranded as well as non-stranded paired-end RNA sequencing, show that there are a lot of alignments in which the XS:A tag appears twice, even though the SAM format specification states that a tag can only appear once in an alignment. The XS:A tag takes a value of "+" or "-", indicating the genomic strand that the RNA that produced a read came from.

    Example command (non-stranded sequencing):
    samtools view accepted_hits.bam | head -n 10000 | grep -P "(XS:A:[+-]).+?(XS:A:[+-])"
    SRR452328.33456849	129	1	17368	50	1M237N77M	6	74227619	0	CAGGTTCTCGGTGGTGTTGAAGAGCAGCAAGGAGCTGACAGAGCTGATGTTGCTGGGAAGACCCCCAAGTCCCTCTTC	=?+A=:BDFAA<AE8+AEGG9CEE3?;E3?F;:)?;GDCAADFHB@@B<)8=@AHG=F9@;7@EA6<?=;@>;6==>@	AS:i:0	XN:i:0	XM:i:0	XO:i:0	XG:i:0	NM:i:0	MD:Z:78	YT:Z:UU	XS:A:-	XS:A:-	NH:i:1
    Is this a bug in tophat2 or bowtie2 (I see it with tophat 2.0.9 as well, which is supposed to have fixed such a bug!)

Latest Articles


  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin

    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM
  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin

    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM





Topics Statistics Last Post
Started by seqadmin, 05-24-2024, 07:15 AM
0 responses
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 10:28 AM
0 responses
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 07:35 AM
0 responses
Last Post seqadmin  
Started by seqadmin, 05-22-2024, 02:06 PM
0 responses
Last Post seqadmin  