Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • yasu
    Member
    • Jul 2009
    • 10

    tophat running problem

    Hi all,

    I'm trying to run mRNA-seq for human by tophat (v1.0.12).
    I succeeded to get proper output file in the preliminary dataset (first 100K reads from each .fq file). But I failed to get proper output in the real dataset (each contains ~17M reads).

    I would appreciate any help you could give me with this.

    Thanks in advance.

    -Yasu

    ### preliminary_test ###

    $ tophat -r 10 -p 8 -o tophat_hg19_test hg19 s_1_1.head4000000.fq,s_6_1.head4000000.fq,s_7_1.head4000000.fq s_1_2.head4000000.fq,s_6_2.head4000000.fq,s_7_2.head4000000.fq

    [Mon Feb 8 13:31:03 2010] Beginning TopHat run (v1.0.12)
    -----------------------------------------------
    [Mon Feb 8 13:31:03 2010] Preparing output location tophat_hg19_test/
    [Mon Feb 8 13:31:03 2010] Checking for Bowtie index files
    [Mon Feb 8 13:31:03 2010] Checking for reference FASTA file
    [Mon Feb 8 13:31:03 2010] Checking for Bowtie
    Bowtie version: 0.11.3.0
    [Mon Feb 8 13:31:03 2010] Checking reads
    seed length: 43bp
    format: fastq
    quality scale: --phred33-quals
    [Mon Feb 8 13:31:51 2010] Mapping reads against hg19 with Bowtie
    [Mon Feb 8 13:34:24 2010] Joining segment hits
    [Mon Feb 8 13:34:59 2010] Mapping reads against hg19 with Bowtie
    [Mon Feb 8 13:37:30 2010] Joining segment hits
    [Mon Feb 8 13:38:04 2010] Searching for junctions via segment mapping
    [Mon Feb 8 13:44:59 2010] Retrieving sequences for splices
    [Mon Feb 8 13:46:42 2010] Indexing splices
    [Mon Feb 8 13:47:58 2010] Mapping reads against segment_juncs with Bowtie
    [Mon Feb 8 13:48:47 2010] Joining segment hits
    [Mon Feb 8 13:49:26 2010] Mapping reads against segment_juncs with Bowtie
    [Mon Feb 8 13:50:15 2010] Joining segment hits
    [Mon Feb 8 13:50:52 2010] Reporting output tracks
    -----------------------------------------------
    Run complete [00:33:58 elapsed]


    ### real_data ###

    tophat -r 10 -p 8 -o tophat_hg19 hg19 s_1_1.fq,s_6_1.fq,s_7_1.fq s_1_2.fq,s_6_2.fq,s_7_2.fq

    [Mon Feb 8 14:24:47 2010] Beginning TopHat run (v1.0.12)
    -----------------------------------------------
    [Mon Feb 8 14:24:47 2010] Preparing output location tophat_hg19/
    [Mon Feb 8 14:24:47 2010] Checking for Bowtie index files
    [Mon Feb 8 14:24:47 2010] Checking for reference FASTA file
    [Mon Feb 8 14:24:47 2010] Checking for Bowtie
    Bowtie version: 0.11.3.0
    [Mon Feb 8 14:24:47 2010] Checking reads
    seed length: 43bp
    format: fastq
    quality scale: --phred33-quals
    [Mon Feb 8 14:39:23 2010] Mapping reads against hg19 with Bowtie
    [Mon Feb 8 15:24:40 2010] Joining segment hits
    [Mon Feb 8 15:35:38 2010] Mapping reads against hg19 with Bowtie
    [Mon Feb 8 16:18:44 2010] Joining segment hits
    [Mon Feb 8 16:18:44 2010] Searching for junctions via segment mapping
    Warning: junction database is empty!
    [Mon Feb 8 18:01:42 2010] Joining segment hits
    [Mon Feb 8 18:11:38 2010] Joining segment hits
    [Mon Feb 8 18:11:38 2010] Reporting output tracks
    [FAILED]
    Error: Report generation failed with err = 1
    Traceback (most recent call last):
    File "/bin/tophat", line 1518, in ?
    sys.exit(main())
    File "/bin/tophat", line 1490, in main
    params.gff_annotation)
    File "/bin/tophat", line 936, in compile_reports
    exit(1)
    TypeError: 'str' object is not callable
  • yasu
    Member
    • Jul 2009
    • 10

    #2
    I add the report.log file from real_data (failed one).

    ### Real_data (reports.log) ###

    tophat_reports v1.0.12
    ---------------------------------------
    Error: cannot open map file for reading

    #####################

    Comparing with the run.log files from preliminary_test (succeeded one) and from real_data (failed one), "/bin/segment_juncs" doesn't work well.

    Can somebody give me any help?

    Thanks,

    -Yasu

    Comment

    • Cole Trapnell
      Senior Member
      • Nov 2008
      • 213

      #3
      The fact that TopHat thinks the seed length is 43bp is concerning. The default is 25, and it shouldn't be different unless you specified --segment-length, which you didn't. TopHat currently requires that FASTQ files have records where all of the nucleotides for each read appear on a single line. Same goes for the quality strings - all the quality characters need to be on one line. This is a limitation I haven't had time to fix yet. Can you verify that your FASTQ file is formatted this way?

      Comment

      • yasu
        Member
        • Jul 2009
        • 10

        #4
        Thanks for your kind help!!

        My fastq file is something like this. I omitted the sequence+position id from the line after "+". Does this make the things bad?

        -Yasu

        ###########
        @HWI-EAS368:1:1:9:316#0/1
        CTGGATGATAACATTCCAGAAGATGACTCAGGTGTCCCCACCC
        +
        BB66AB9ACBB@BCBAAA><BBBAAB?BBB@@@BA?B@BB@AB
        @HWI-EAS368:1:1:9:424#0/1
        CTCCCTGCCAGATATCGAGGAGGTGAAAGACCAGAGCAGGAAC
        +
        BCBBB>?>@CBABBB;A877??.:<<B@;@@?=>?A>?6AAA?
        @HWI-EAS368:1:1:9:1060#0/1
        TGGATGGTTCAGGATAATCACCTGAGCAGTGAAGCCAGCTGCT
        +
        BBBBB=?@BBB?=@A9AA@CAA><<@:5>7?=A?A@?=A???@
        @HWI-EAS368:1:1:9:410#0/1
        CGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCAGCTTCACCCG
        +
        AA9AAA=:A7'=7=?4+366=AA@:A>999B:=2,=>1014>7
        @HWI-EAS368:1:1:9:807#0/1
        CGAACATTTCTGGCCCCCAAGTGTCAGCCCATTCACGTAAAAA
        +
        BBBBBBC@@<:;6BC>:@2<B=BBB@7;BB=:C@799:BBB?%
        @HWI-EAS368:1:1:9:405#0/1
        TGTAAAGCCTGAAACAGCTGCCTGTGTGGGACTGAGATGCAGG
        +
        ?=>B=AA@AB@AAB?88>@@@BB>?B>A<=>?A81<-<@@B@@

        Comment

        • yasu
          Member
          • Jul 2009
          • 10

          #5
          I added the '--segment-length 25', but the comment is still as follows;

          [Tue Feb 9 16:47:40 2010] Checking reads
          seed length: 43bp
          format: fastq
          quality scale: --phred33-quals

          Did I go some wrong way?

          -Yasu

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by SEQadmin2



            Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
            ...
            07-09-2026, 11:10 AM
          • SEQadmin2
            Cancer Drug Resistance: The Lingering Barrier to Rising Survival
            by SEQadmin2



            Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

            There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
            07-08-2026, 05:17 AM
          • GATTACAT
            Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
            by GATTACAT
            Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
            07-01-2026, 11:43 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, 07-13-2026, 10:26 AM
          0 responses
          27 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-09-2026, 10:04 AM
          0 responses
          37 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-08-2026, 10:08 AM
          0 responses
          24 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-07-2026, 11:05 AM
          0 responses
          34 views
          0 reactions
          Last Post SEQadmin2  
          Working...