Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • repinementer
    Member
    • Dec 2009
    • 80

    #1

    MACS-ChIP seq-Error

    Code:
    Traceback (most recent call last):
      File "/home/taoliu/bin/macs", line 273, in <module>
        main()
      File "/home/taoliu/bin/macs", line 71, in main
        options.bg_redundant = bg_r (treat,options.max_dup_tags) # average
      File "/home/taoliu/bin/macs", line 225, in bg_r
        return float(total_duplicates)/(total_tags)
    ZeroDivisionError: float division
    I used the foolwing command and got above error. Is any one know what this is?
    Code:
    $ macs --format ELAND -t CMM028_191_unique_hits.txt -c CMM027_027_unique_hits.txt --name=CM28 --gsize=2473000000 --tsize=35 --mfold=25 --diag --wig
  • Xi Wang
    Senior Member
    • Oct 2009
    • 317

    #2
    First of all, you should check your Eland format, make sure it follows the following description, which is copied from MACS manual: http://liulab.dfci.harvard.edu/MACS/00README.html


    If the format is ELAND, the file must be ELAND output file, each line MUST represents only ONE tag, with fields of:

    1. Sequence name (derived from file name and line number if format is not Fasta)
    2. Sequence
    3. Type of match: NM - no match found. QC - no matching done: QC failure (too many Ns basically). RM - no matching done: repeat masked (may be seen if repeatFile.txt was specified). U0 - Best match found was a unique exact match. U1 - Best match found was a unique 1-error match. U2 - Best match found was a unique 2-error match. R0 - Multiple exact matches found. R1 - Multiple 1-error matches found, no exact matches. R2 - Multiple 2-error matches found, no exact or 1-error matches.
    4. Number of exact matches found.
    5. Number of 1-error matches found.
    6. Number of 2-error matches found. Rest of fields are only seen if a unique best match was found (i.e. the match code in field 3 begins with "U").
    7. Genome file in which match was found.
    8. Position of match (bases in file are numbered starting at 1).
    9. Direction of match (F=forward strand, R=reverse).
    10. How N characters in read were interpreted: ("."=not applicable, "D"=deletion, "I"=insertion). Rest of fields are only seen in the case of a unique inexact match (i.e. the match code was U1 or U2).
    11. Position and type of first substitution error (e.g. 12A: base 12 was A, not whatever is was in read).
    12. Position and type of first substitution error, as above.
    Xi Wang

    Comment

    • repinementer
      Member
      • Dec 2009
      • 80

      #3
      Yep. Thanx

      Ya I found out my format is GERALD(-Illumina). Wasted almost 3 hours to convert GERALD to BED or ELAND. Still no result.

      Found a perl script but it's for Solexa and Peakfinder package (Unfortunately jar files are not working (May be some Java file installation problems in my PC)).

      Now writing my own script to modify the format......

      Comment

      • repinementer
        Member
        • Dec 2009
        • 80

        #4
        Could any one post GERALD format with simple text file and ELAND format with a simple text file.

        Thanx

        Comment

        • repinementer
          Member
          • Dec 2009
          • 80

          #5
          Is it GERALD format?

          Code:
          GERALD															
          1	2	3	4	5	6	7	8	9	10	11	12	13	14	15
          B2GA005	1	1	95	1341	615	0	1	TAGTAGAGGCCCCCAATGTGGTCCAAGATTCCCTA	ggggggggggggggggggggghggggegggggggg	chr1.fa		3000839	R	35	113
          B2GA005	1	1	79	902	907	0	1	GAAAGGGACCACTGTGGGATGGAAGTGGACGTGAG	gdgdggdgbggfggfggceffeY^e[ecVYc]`]`	chr1.fa		3001342	R	26T8	71
          B2GA005	1	1	47	804	221	0	1	TAGTGGGAACAAGCTGACAGCTCTGTGTTCTGCTT	ggggggggggggggggggggggggggggggggggg	chr1.fa		3001805	F	35	87
          If it is. COuld you please explain the values in columns referring to? so that I could convert into ELAND
          Last edited by repinementer; 02-09-2010, 01:45 AM.

          Comment

          • repinementer
            Member
            • Dec 2009
            • 80

            #6
            GERALD to BED..Script

            But still not sure with F and R definitions I gave..

            Code:
            repine@pc499 ~/MACS-1.3.7.1
            $ awk '$13 == "R" {print $11,"\t",$12+35,"\t",$12,"\t",$13,"\t",$1} $13 == "F" {print $11,"\t",$12,"\t",$12+35,"\t",$13,"\t",$1}' CMM027_027_unique_hits.txt |tr 'F' '+' |tr 'R' '-'|tr -d '.fa'

            Comment

            Latest Articles

            Collapse

            • SEQadmin2
              Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
              by SEQadmin2



              CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

              Despite this, “CRISPR helped turn genome editing from a specialized technique into
              ...
              07-31-2026, 11:01 AM
            • SEQadmin2
              Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
              by SEQadmin2


              Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

              The systematic characterization of the human proteome has
              ...
              07-20-2026, 11:48 AM
            • SEQadmin2
              Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
              by SEQadmin2



              Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
              ...
              07-09-2026, 11:10 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, 08-03-2026, 10:13 AM
            0 responses
            21 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-31-2026, 02:55 AM
            0 responses
            34 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-24-2026, 12:17 PM
            0 responses
            25 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-23-2026, 11:41 AM
            0 responses
            21 views
            0 reactions
            Last Post SEQadmin2  
            Working...