I am using the following command:
Code:
findMotifs.pl input.fa fasta ./Output -fastaBg bg.fa -len 8,10,12 -norevopp
Code:
>ENSMUST00000027125_Coq10b_mmu_chr1_55071635_55072702_+_utr_55071803_55072702(+) ATTTCTTTTGAATTCCGCTCCCTTCTGCACTCTCAGCTCGCTACTCTGTTCTTCGATGAAGTTGTGAAACAAATGGTAGC AGCCTTTGAAAGAAGAGCCTGTAAACTGTATGGTCCAGAGACAAACATACCTCGGGAATTAATGCTTCATGAAATTCACC ACACCTAAGAGGAAAATATTAGCTGCCTCCACCTACTCTTGGCTAGTTTGTTCACTTCTAGGAAGTCCTTTTACCATCTG` TTGAGAAGTCAGAAAGCATTTGTTAAACCTGCCTTGATTCTAAGCCCGTGCTGTTGAAAATTTGCACATTGAACATGGAC CCACTTGTACATAGAATTATTTCTTCAATCAAGTGTGACTCTAAGTATCATGTACATTTGCAGGCTCCGACCACCTTTGT AATAACGGATGTCATCACTGTTGCTAGGATACCACATTCCTCGTTTGAGTGTACAGATGAACAAGTCTTTTAATTCTCAC CTTACATGAAAAGGTTAGCTGAGATACAATGTGTGTTATATTAACCATATCATGTTTAAGTTATTAGGTTCAGAGTATTT GTAACTTATTGTTATTCGGCATGCCATATGGCTTAGGGTATTTGAATAATCATATATTTACCATTAAAACTGTGATTTAA AGTATTGCTAATGAAGTCTTAGCACTTTGGGTATTTTAATTGTTCTTATGGGTAGCAGTAGATGATTCAGTGTTGTTGGG
But I get the following error:
Code:
Selected Options: Input file = /media/sequentia/synology_office2/Projects/554-Belloc/RIPseq/APAdetection/cpeb4_target.fa Promoter Set = fasta Output Directory = ./CPEB4 Will use FASTA files for motif finding Target Sequences = /media/sequentia/synology_office2/Projects/554-Belloc/RIPseq/APAdetection/cpeb4_target.fa Background Sequences = /media/sequentia/synology_office2/Projects/554-Belloc/RIPseq/APAdetection/most_used_cpeb4.fa Motif length set at 8, 10, 12, Will not search the reverse strand Using custom gene IDs for GO analysis Parsing FASTA format files... Progress: Step4 - removing redundant promoters Progress: Step5 - adjusting background sequences for GC/CpG content... Sequences processed: 0 total Frequency Bins: 0.2 0.25 0.3 0.35 0.4 0.45 0.5 0.6 0.7 0.8 Freq Bin Count Illegal division by zero at /software/HOMER/bin/assignGeneWeights.pl line 63. Normalizing lower order oligos using homer2 Reading input files... 0 total sequences read Autonormalization: 1-mers (4 total) A inf% inf% -nan C inf% inf% -nan G inf% inf% -nan T inf% inf% -nan Autonormalization: 2-mers (16 total) AA inf% inf% -nan CA inf% inf% -nan GA inf% inf% -nan TA inf% inf% -nan AC inf% inf% -nan CC inf% inf% -nan GC inf% inf% -nan TC inf% inf% -nan AG inf% inf% -nan CG inf% inf% -nan GG inf% inf% -nan TG inf% inf% -nan AT inf% inf% -nan CT inf% inf% -nan GT inf% inf% -nan TT inf% inf% -nan Autonormalization: 3-mers (64 total) Normalization weights can be found in file: ./CPEB4/seq.autonorm.tsv Converging on autonormalization solution: ............................................................................... Final normalization: Autonormalization: 1-mers (4 total) A inf% inf% -nan C inf% inf% -nan (base) [B]idetoma@sequentia[/B]:[B]/media/sequentia/synology_office2/Projects/554-Belloc/RIPseq/motifs[/B]$ more nohup.out Selected Options: Input file = /media/sequentia/synology_office2/Projects/554-Belloc/RIPseq/APAdetection/cpeb4_target.fa Promoter Set = fasta Output Directory = ./CPEB4 Will use FASTA files for motif finding Target Sequences = /media/sequentia/synology_office2/Projects/554-Belloc/RIPseq/APAdetection/cpeb4_target.fa Background Sequences = /media/sequentia/synology_office2/Projects/554-Belloc/RIPseq/APAdetection/most_used_cpeb4.fa Motif length set at 8, 10, 12, Will not search the reverse strand Using custom gene IDs for GO analysis Parsing FASTA format files... Progress: Step4 - removing redundant promoters Progress: Step5 - adjusting background sequences for GC/CpG content... Sequences processed: 0 total Frequency Bins: 0.2 0.25 0.3 0.35 0.4 0.45 0.5 0.6 0.7 0.8 Freq Bin Count Illegal division by zero at /software/HOMER/bin/assignGeneWeights.pl line 63. Normalizing lower order oligos using homer2 Reading input files... 0 total sequences read Autonormalization: 1-mers (4 total) A inf% inf% -nan C inf% inf% -nan G inf% inf% -nan T inf% inf% -nan Autonormalization: 2-mers (16 total) AA inf% inf% -nan CA inf% inf% -nan GA inf% inf% -nan TA inf% inf% -nan AC inf% inf% -nan CC inf% inf% -nan GC inf% inf% -nan TC inf% inf% -nan AG inf% inf% -nan CG inf% inf% -nan GG inf% inf% -nan TG inf% inf% -nan AT inf% inf% -nan CT inf% inf% -nan GT inf% inf% -nan TT inf% inf% -nan Autonormalization: 3-mers (64 total) Normalization weights can be found in file: ./CPEB4/seq.autonorm.tsv Converging on autonormalization solution: ............................................................................... Final normalization: Autonormalization: 1-mers (4 total) A inf% inf% -nan C inf% inf% -nan G inf% inf% -nan T inf% inf% -nan Autonormalization: 2-mers (16 total) AA inf% inf% -nan CA inf% inf% -nan GA inf% inf% -nan TA inf% inf% -nan AC inf% inf% -nan CC inf% inf% -nan GC inf% inf% -nan TC inf% inf% -nan AG inf% inf% -nan CG inf% inf% -nan GG inf% inf% -nan TG inf% inf% -nan AT inf% inf% -nan CT inf% inf% -nan GT inf% inf% -nan TT inf% inf% -nan Autonormalization: 3-mers (64 total) Progress: Step6 - Gene Ontology Enrichment Analysis Skipping... Progress: Step7 - Known motif enrichment Reading input files... 0 total sequences read 1006 motifs loaded Cache length = 11180 Using hypergeometric scoring Checking enrichment of 1006 motif(s) |0% 50% 100%| ================================================================================= Illegal division by zero at /software/HOMER/bin/findKnownMotifs.pl line 152. Progress: Step8 - De novo motif finding (HOMER) Scanning input files... !!! Something is wrong... are you sure you chose the right length for motif finding? !!! i.e. also check your sequence file!!! Scanning input files... !!! Something is wrong... are you sure you chose the right length for motif finding? !!! i.e. also check your sequence file!!! -blen automatically set to 2 Scanning input files... !!! Something is wrong... are you sure you chose the right length for motif finding? !!! i.e. also check your sequence file!!! Use of uninitialized value in numeric gt (>) at /software/HOMER/bin/compareMotifs.pl line 1394. !!! Filtered out all motifs!!! Job finished
What could be the problem?