Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Forum:Problem with homer in findMotifs.pl when using input and bg fasta



    I am using the following command:

    Code:
    findMotifs.pl input.fa fasta ./Output -fastaBg bg.fa -len 8,10,12 -norevopp
    The input and bg fasta have this structure and the bg fasta include all sequences in input plus many others:

    Code:
    >ENSMUST00000027125_Coq10b_mmu_chr1_55071635_55072702_+_utr_55071803_55072702(+)
    ATTTCTTTTGAATTCCGCTCCCTTCTGCACTCTCAGCTCGCTACTCTGTTCTTCGATGAAGTTGTGAAACAAATGGTAGC AGCCTTTGAAAGAAGAGCCTGTAAACTGTATGGTCCAGAGACAAACATACCTCGGGAATTAATGCTTCATGAAATTCACC ACACCTAAGAGGAAAATATTAGCTGCCTCCACCTACTCTTGGCTAGTTTGTTCACTTCTAGGAAGTCCTTTTACCATCTG` TTGAGAAGTCAGAAAGCATTTGTTAAACCTGCCTTGATTCTAAGCCCGTGCTGTTGAAAATTTGCACATTGAACATGGAC CCACTTGTACATAGAATTATTTCTTCAATCAAGTGTGACTCTAAGTATCATGTACATTTGCAGGCTCCGACCACCTTTGT AATAACGGATGTCATCACTGTTGCTAGGATACCACATTCCTCGTTTGAGTGTACAGATGAACAAGTCTTTTAATTCTCAC CTTACATGAAAAGGTTAGCTGAGATACAATGTGTGTTATATTAACCATATCATGTTTAAGTTATTAGGTTCAGAGTATTT GTAACTTATTGTTATTCGGCATGCCATATGGCTTAGGGTATTTGAATAATCATATATTTACCATTAAAACTGTGATTTAA AGTATTGCTAATGAAGTCTTAGCACTTTGGGTATTTTAATTGTTCTTATGGGTAGCAGTAGATGATTCAGTGTTGTTGGG

    But I get the following error:

    Code:
    Selected Options:
    
    Input file = /media/sequentia/synology_office2/Projects/554-Belloc/RIPseq/APAdetection/cpeb4_target.fa
    
    Promoter Set = fasta
    
    Output Directory = ./CPEB4
    
    Will use FASTA files for motif finding
    
    Target Sequences = /media/sequentia/synology_office2/Projects/554-Belloc/RIPseq/APAdetection/cpeb4_target.fa
    
    Background Sequences = /media/sequentia/synology_office2/Projects/554-Belloc/RIPseq/APAdetection/most_used_cpeb4.fa
    
    Motif length set at 8, 10, 12,
    
    Will not search the reverse strand
    
    Using custom gene IDs for GO analysis
    
    Parsing FASTA format files...
    
    
    
    
    Progress: Step4 - removing redundant promoters
    
    
    
    
    Progress: Step5 - adjusting background sequences for GC/CpG content...
    
    
    
    
    Sequences processed:
    
    0 total
    
    
    
    
    Frequency Bins: 0.2 0.25 0.3 0.35 0.4 0.45 0.5 0.6 0.7 0.8
    
    Freq Bin Count
    
    Illegal division by zero at /software/HOMER/bin/assignGeneWeights.pl line 63.
    
    
    
    
    Normalizing lower order oligos using homer2
    
    
    
    
    Reading input files...
    
    0 total sequences read
    
    Autonormalization: 1-mers (4 total)
    
    A inf% inf% -nan
    
    C inf% inf% -nan
    
    G inf% inf% -nan
    
    T inf% inf% -nan
    
    Autonormalization: 2-mers (16 total)
    
    AA inf% inf% -nan
    
    CA inf% inf% -nan
    
    GA inf% inf% -nan
    
    TA inf% inf% -nan
    
    AC inf% inf% -nan
    
    CC inf% inf% -nan
    
    GC inf% inf% -nan
    
    TC inf% inf% -nan
    
    AG inf% inf% -nan
    
    CG inf% inf% -nan
    
    GG inf% inf% -nan
    
    TG inf% inf% -nan
    
    AT inf% inf% -nan
    
    CT inf% inf% -nan
    
    GT inf% inf% -nan
    
    TT inf% inf% -nan
    
    Autonormalization: 3-mers (64 total)
    
    Normalization weights can be found in file: ./CPEB4/seq.autonorm.tsv
    
    Converging on autonormalization solution:
    
    ...............................................................................
    
    Final normalization: Autonormalization: 1-mers (4 total)
    
    A inf% inf% -nan
    
    C inf% inf% -nan
    
    (base) [B]idetoma@sequentia[/B]:[B]/media/sequentia/synology_office2/Projects/554-Belloc/RIPseq/motifs[/B]$ more nohup.out
    
    
    
    
    Selected Options:
    
    Input file = /media/sequentia/synology_office2/Projects/554-Belloc/RIPseq/APAdetection/cpeb4_target.fa
    
    Promoter Set = fasta
    
    Output Directory = ./CPEB4
    
    Will use FASTA files for motif finding
    
    Target Sequences = /media/sequentia/synology_office2/Projects/554-Belloc/RIPseq/APAdetection/cpeb4_target.fa
    
    Background Sequences = /media/sequentia/synology_office2/Projects/554-Belloc/RIPseq/APAdetection/most_used_cpeb4.fa
    
    Motif length set at 8, 10, 12,
    
    Will not search the reverse strand
    
    Using custom gene IDs for GO analysis
    
    Parsing FASTA format files...
    
    
    
    
    Progress: Step4 - removing redundant promoters
    
    
    
    
    Progress: Step5 - adjusting background sequences for GC/CpG content...
    
    
    
    
    Sequences processed:
    
    0 total
    
    
    
    
    Frequency Bins: 0.2 0.25 0.3 0.35 0.4 0.45 0.5 0.6 0.7 0.8
    
    Freq Bin Count
    
    Illegal division by zero at /software/HOMER/bin/assignGeneWeights.pl line 63.
    
    
    
    
    Normalizing lower order oligos using homer2
    
    
    
    
    Reading input files...
    
    0 total sequences read
    
    Autonormalization: 1-mers (4 total)
    
    A inf% inf% -nan
    
    C inf% inf% -nan
    
    G inf% inf% -nan
    
    T inf% inf% -nan
    
    Autonormalization: 2-mers (16 total)
    
    AA inf% inf% -nan
    
    CA inf% inf% -nan
    
    GA inf% inf% -nan
    
    TA inf% inf% -nan
    
    AC inf% inf% -nan
    
    CC inf% inf% -nan
    
    GC inf% inf% -nan
    
    TC inf% inf% -nan
    
    AG inf% inf% -nan
    
    CG inf% inf% -nan
    
    GG inf% inf% -nan
    
    TG inf% inf% -nan
    
    AT inf% inf% -nan
    
    CT inf% inf% -nan
    
    GT inf% inf% -nan
    
    TT inf% inf% -nan
    
    Autonormalization: 3-mers (64 total)
    
    Normalization weights can be found in file: ./CPEB4/seq.autonorm.tsv
    
    Converging on autonormalization solution:
    
    ...............................................................................
    
    Final normalization: Autonormalization: 1-mers (4 total)
    
    A inf% inf% -nan
    
    C inf% inf% -nan
    
    G inf% inf% -nan
    
    T inf% inf% -nan
    
    Autonormalization: 2-mers (16 total)
    
    AA inf% inf% -nan
    
    CA inf% inf% -nan
    
    GA inf% inf% -nan
    
    TA inf% inf% -nan
    
    AC inf% inf% -nan
    
    CC inf% inf% -nan
    
    GC inf% inf% -nan
    
    TC inf% inf% -nan
    
    AG inf% inf% -nan
    
    CG inf% inf% -nan
    
    GG inf% inf% -nan
    
    TG inf% inf% -nan
    
    AT inf% inf% -nan
    
    CT inf% inf% -nan
    
    GT inf% inf% -nan
    
    TT inf% inf% -nan
    
    Autonormalization: 3-mers (64 total)
    
    
    
    
    Progress: Step6 - Gene Ontology Enrichment Analysis
    
    Skipping...
    
    
    
    
    Progress: Step7 - Known motif enrichment
    
    
    
    
    Reading input files...
    
    0 total sequences read
    
    1006 motifs loaded
    
    Cache length = 11180
    
    Using hypergeometric scoring
    
    Checking enrichment of 1006 motif(s)
    
    |0% 50% 100%|
    
    =================================================================================
    
    Illegal division by zero at /software/HOMER/bin/findKnownMotifs.pl line 152.
    
    
    
    
    Progress: Step8 - De novo motif finding (HOMER)
    
    
    
    
    Scanning input files...
    
    !!! Something is wrong... are you sure you chose the right length for motif finding?
    
    !!! i.e. also check your sequence file!!!
    
    
    
    
    Scanning input files...
    
    !!! Something is wrong... are you sure you chose the right length for motif finding?
    
    !!! i.e. also check your sequence file!!!
    
    
    
    
    -blen automatically set to 2
    
    Scanning input files...
    
    !!! Something is wrong... are you sure you chose the right length for motif finding?
    
    !!! i.e. also check your sequence file!!!
    
    Use of uninitialized value in numeric gt (>) at /software/HOMER/bin/compareMotifs.pl line 1394.
    
    !!! Filtered out all motifs!!!
    
    Job finished

    What could be the problem?

Latest Articles

Collapse

  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Today, 10:28 AM
0 responses
8 views
0 likes
Last Post seqadmin  
Started by seqadmin, Today, 07:35 AM
0 responses
11 views
0 likes
Last Post seqadmin  
Started by seqadmin, Yesterday, 02:06 PM
0 responses
8 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-14-2024, 07:03 AM
0 responses
28 views
0 likes
Last Post seqadmin  
Working...
X