Sorry not a sequencing question exactly, but I thought this might still be a good place to ask (is there a better place to ask microarray questions?).
Most of the time if I get the target sequence for a probeset from the NetAffx website and then do a BLAT search the probeset aligns to the same strand as the transcript/gene it's detecting. For example, this one aligns to the "+" strand and detects the gene Cxcr2 which is also on the "+" strand:
This one aligns to the "-" strand and detects the gene Ntn1 which is also on the "-" strand:
This is an example of a probeset I'm having a problem with:
According to Affymetrix it detects the gene Fam117b, except that the probeset aligns to the "-" strand while the gene is on the "+" strand. So is it really detecting the Fam117b gene (and if so, how?), or is it actually detecting an antisense transcript that happens to be transcribed from within the Fam117b gene but from the opposite strand? Are microarrays strand-specific?
Most of the time if I get the target sequence for a probeset from the NetAffx website and then do a BLAT search the probeset aligns to the same strand as the transcript/gene it's detecting. For example, this one aligns to the "+" strand and detects the gene Cxcr2 which is also on the "+" strand:
Code:
>MOUSE430_2:1421734_AT gcatggcatcattaccagagactgtggtatttgaattgatgcagcccctcctctacatta cagggagaaagaggtcacgttcttcttagcagagccccccagagttttagaaccccctat atggctgtctgacccccttcatcattggtatgcctactgatagagttgatccatcctaac actgagaccccaaacactcttttctaagaagcacactttacaattacgtgagatctgcct ctacccatgcagaacagttagcagtaaaggaagaggtggaggagtagaaaatggcaagtg acaatgagaagtagaaaaagggaactcttcaccttaccagtagacgagtaccagagtccc ctcacacaggaaatagca
Code:
>MOUSE430_2:1422987_AT gtgaacatcatctccgtgtacaagcagggcacaagtcgtattcgccgtggtgaccagagt ttgtggatccgctcacgagacatcgcctgcaagtgtcccaaaatcaagcccctcaagaag tacttgctgttgggtaatgccgaggactcacctgaccagagtggcatcgtggcagacaag agcagcctggtgatccagtggcgggacacatgggcacggcggctgcgcaagttccagcaa cgggagaagaagggcaagtgcaagaaggcctagcgcggaggtggcgcgggctccaggagg gcgggcagggcgctggcaaaggctggcagccttggacttggccgtcaggggttttttngg gagggtgggggcggggcgaagtcgaagtggggcggggccctcagcggctccgccccagac ccaccctcacacccctggctgcgctcttatgcgcatggcagaaagcaccctg
Code:
>MOUSE430_2:1446891_AT atcaactcctaccaatgttaccatgtaatttgataaaaatttgaatctttaactctgaaa gtgacctggaagttaaaaacacgatgggggaataaacacagaaagtgggtgtctgtgagt tcatcgtgctctacatagtgaaatcccaagacagcctaggctctggaaagagaccctatc tggaaaaaagattcccaagcaaataaatgaaactacttttaaactgttaacaggatacac ctcccagatgaaactattttgtagatttaagggagggaaaaaggctgtgatttatgagtt aaaccactgtttcatacatggttttggatattctaacctaaatgattacaaacaacctag aagagaagcaatctctttccttacctggctctggttaatagctgcatggttgccatggaa tggagactgcctttctttatctcggtggtgacgactgctgtgtttgcttctctgcagttg ctggcgtaattttgcaatctgaaa
Comment