Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Bedtools bamToBed paired end problems

    I have generated artificial sequences with Sherman and aligned them using bwa. I then used samtools to sort the read and generate a bam file.

    The file is sorted by name as required by the bamToBed -bedpe option.

    bedToBam -bedpe -i myFile.bam > myFile.bed

    When I run this I get this error for every single read

    *****WARNING: Query 6390_chr10:91632437-91632600_R1 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping.

    Here is a sample of my input for reference:

    4_chr2:183066786-183066895_R1 83 chr2 183066795 60 101M = 183066787 -109 AGTCATAATTCCTAAATATTATTATTTTTAATCTGAAAGGAACTTTAGCCATTTTAAAGAAAAACTATTCCAAATACAGTATTATATAGTATTTCAATGCT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:101
    4_chr2:183066786-183066895_R2 163 chr2 183066787 60 101M = 183066795 109 TCTTCTGCAGTCATAATTCCTAAATATTATTATTTTTAATCTGAAAGGAACTTTAGCCATTTTAAAGAAAAACTATTCCAAATACAGTATTATATAGTATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:101

    here is a sample of my header:

    @HD VN:1.3 SO:queryname
    @SQ SN:chrM LN:16571
    @SQ SN:chr1 LN:249250621
    @SQ SN:chr2 LN:243199373
    @SQ SN:chr3 LN:198022430
    @SQ SN:chr4 LN:191154276
    @SQ SN:chr5 LN:180915260




    I have tried adding a /1 or /2 to the end of the name but no luck. Any thoughts?

  • #2
    solution

    I figured it out.

    In case anyone has the same problem as me - bedTools expects that the QNAME field is idnetical for the pair.

    Comment

    Latest Articles

    Collapse

    • seqadmin
      The Impact of AI in Genomic Medicine
      by seqadmin



      Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
      02-26-2024, 02:07 PM
    • seqadmin
      Multiomics Techniques Advancing Disease Research
      by seqadmin


      New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

      A major leap in the field has
      ...
      02-08-2024, 06:33 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 02-23-2024, 04:11 PM
    0 responses
    57 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 02-21-2024, 08:52 AM
    0 responses
    67 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 02-20-2024, 08:57 AM
    0 responses
    55 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 02-14-2024, 09:19 AM
    0 responses
    65 views
    0 likes
    Last Post seqadmin  
    Working...
    X