Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • MurielGB
    Member
    • Oct 2013
    • 51

    #1

    Problem Picard "Alignment start should != 0 because reference name != *"

    Hello,

    Using Picard Validation, I obtain this message for some reads : Alignment start should != 0 because reference name != *
    If I grep the read in the SAM file, I can see that the read is mapped (there is the name of a reference scaffold in the third column) but the position (column 4) is 0.
    This is very strange, how can this happen ?
    Do you know how to fix this ?

    Thanks,

    Muriel
  • dpryan
    Devon Ryan
    • Jul 2011
    • 3478

    #2
    What's the flag on that read?

    Comment

    • MurielGB
      Member
      • Oct 2013
      • 51

      #3
      Hello,

      After doing bwa aln and bwa sampe, I obtain a sam file and I use Picard ValidateSamFile.
      The errors are :
      ERROR: Record 38208, Read name HWI-ST1206:14:C296WACXX:6:1101:8672:9595, Mate negative strand flag does not match read negative strand flag of mate
      ERROR: Record 40751, Read name HWI-ST1206:14:C296WACXX:6:1101:8820:10033, Alignment start should != 0 because reference name != *.
      If I grep the read with the second problem, here is what I obtain :
      HWI-ST1206:14:C296WACXX:6:1101:8820:10033 113 gi|300388125|ref|NC_013991.2| 0 25 46M =176 215 GTACTTTTTTTTTTAGTATTTTAATTTTGTATTTATTATTTATATT >GCGAGGEIIIHHGHHIHE@HHC:CA<<AAGC>DFHFFDDDDD@@<RG:Z:Pa1370-Seq1 XT:A:U NM:i:0 SM:i:25 AM:i:25 X0:i:1 X1:i:1 XM:i:3 XO:i:0 XG:i:0 MD:Z:0 XA:Z:gi|300388125|ref|NC_013991.2|,-86195,4M1D42M,1;

      HWI-ST1206:14:C296WACXX:6:1101:8820:10033 177 gi|300388125|ref|NC_013991.2| 176 37 85M =0 -215 GCAGCTAGGTCTAGAGGGAAGTTGTGAGCATTACGTTCATGCATTACTTCCATACCAAGGTTAGCACGGTTGATGATACCAGCCC @@@@@>@@>;;;AA=>BBBA<BBBBAA:BA=;B=9??ABBBBBBBBAA>BA<?*BABBB>C?AC7<CC@>A>72BC@@)=<A=== RG:Z:Pa1370-Seq1 XT:A:UNM:i:1 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:78T6
      Any idea on how I can have a read map but no position given ???

      Thanks !

      Muriel

      Comment

      • dpryan
        Devon Ryan
        • Jul 2011
        • 3478

        #4
        That would seem to be a bug.

        Comment

        • MurielGB
          Member
          • Oct 2013
          • 51

          #5
          OK thanks !
          Any idea on what I can do ?

          Comment

          • dpryan
            Devon Ryan
            • Jul 2011
            • 3478

            #6
            Try emailing the list.

            Comment

            • MurielGB
              Member
              • Oct 2013
              • 51

              #7
              OK, i will, thanks for your help !
              Muriel

              Comment

              • glopez
                Junior Member
                • Mar 2013
                • 2

                #8
                Hi Muriel,

                I am facing the same problem. Did you find a solution for it?

                Thanks and kind regards

                Comment

                • MurielGB
                  Member
                  • Oct 2013
                  • 51

                  #9
                  Hello !
                  Well, what I did is a personal arrangement. I should probably write to the mailing list, I don't remember if I did or not ahah !!
                  The problem is that some read are supposedly mapped on the reference because there is a scaffold name in the column 3, but the starting position (column 4) of the read is 0 and this is the problem.
                  Here is what I did :

                  ### List reads that have "Alignment start should != 0 because reference name != *"
                  samtools view -h input.bam | awk 'BEGIN {OFS="\t";} {if ($1=="^@") {print $0;} else {if ($4==0 && $3!="*") {$4=1; print $1>"read_file"} if ($8==0 && $7!="*") {$8=1;print $1>"read_file"} print $0;}}' | samtools view -bS - > input_OK.bam ; sort read_file | uniq > read_file_sorted

                  ### Exclude problematic reads
                  #java -Xmx20g -jar FilterSamReads.jar INPUT=INPUT_OK.bam FILTER=excludeReadList READ_LIST_FILE=read_file_sorted OUTPUT=output.bam

                  Good luck !

                  Muriel

                  Comment

                  • glopez
                    Junior Member
                    • Mar 2013
                    • 2

                    #10
                    Hi Muriel,

                    THanks for your reply!!

                    Kind regards

                    Comment

                    Latest Articles

                    Collapse

                    • SEQadmin2
                      Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                      by SEQadmin2



                      CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                      Despite this, “CRISPR helped turn genome editing from a specialized technique into
                      ...
                      Today, 11:01 AM
                    • SEQadmin2
                      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                      by SEQadmin2


                      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                      The systematic characterization of the human proteome has
                      ...
                      07-20-2026, 11:48 AM
                    • SEQadmin2
                      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                      by SEQadmin2



                      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                      ...
                      07-09-2026, 11:10 AM

                    ad_right_rmr

                    Collapse

                    News

                    Collapse

                    Topics Statistics Last Post
                    Started by SEQadmin2, Today, 02:55 AM
                    0 responses
                    8 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 07-24-2026, 12:17 PM
                    0 responses
                    12 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 07-23-2026, 11:41 AM
                    0 responses
                    12 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 07-20-2026, 11:10 AM
                    0 responses
                    24 views
                    0 reactions
                    Last Post SEQadmin2  
                    Working...