Tweet
hi There,
I am getting this error while running VFS (http://sourceforge.net/projects/viralfusionseq/) (VERSION: Revision 1250) on CentOS 5 release 5.10 (Final) system. After this error SSAKE also fails. Please let me know how this can be fixed. The portions of error output are below. Thanks for the help.
I am getting this error while running VFS (http://sourceforge.net/projects/viralfusionseq/) (VERSION: Revision 1250) on CentOS 5 release 5.10 (Final) system. After this error SSAKE also fails. Please let me know how this can be fixed. The portions of error output are below. Thanks for the help.
Code:
[COLOR="Teal"][B][SIZE="4"]Command[/SIZE][/B][/COLOR]
perl 2.run.example.dataset.pl
[FONT="Times New Roman"][B]The file "2.run.example.dataset.pl" has a the following command:[/B][/FONT]
perl viral.fusion.pl --config vfs.conf --insertSIZE 350 HKCI5a CL7R_1_VFS.fq CL7R_2_VFS.fq
[FONT="Times New Roman"][B]Both the fq files are included in vfs and I edited vfs.conf file to include the path of 3rd party software[/B].[/FONT]
[COLOR="Teal"][B][SIZE="4"]Error 1[/SIZE][/B][/COLOR]
Hashing CL7R_1_VFS.dynamic.min35.fq.gz
Hashing CL7R_2_VFS.dynamic.min35.fq.gz
Use of uninitialized value in concatenation (.) or string at
/data3/users/arun/Apps/vfs/include/RPmethod.pm line 268 (#1)
(W uninitialized) An undefined value was used as if it were already
defined. It was interpreted as a "" or a 0, but maybe it was a mistake.
To suppress this warning assign a defined value to your variables.
To help you figure out what was undefined, perl tells you what operation
you used the undefined value in. Note, however, that perl optimizes your
program and the operation displayed in the warning may not necessarily
appear literally in your program. For example, "that $foo" is
usually optimized into "that " . $foo, and the warning will refer to
the concatenation (.) operator, even though there is no . in your
program.
Hashing vfs_dev.HKCI5a.4h_map.fq
Entering Essential::tx_targeted_assembly.
Skipped Insert Size estimation. Supplied insert size: 350
Essential::ssake_reads_prep
Assuming fasta file
Hashing vfs_dev.HKCI5a.RPm.out_2.fa
Processing vfs_dev.HKCI5a.RPm.out_1.fa and vfs_dev.HKCI5a.RPm.out_2.fa
Use of uninitialized value in pattern match (m//) at
/data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 2 (#1)
Use of uninitialized value in concatenation (.) or string at
/data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 2 (#1)
Use of uninitialized value in pattern match (m//) at
/data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 4 (#1)
Use of uninitialized value in concatenation (.) or string at
/data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 4 (#1)
--------------continued to even no of lines (6,8,10,12,14...36)--------------
/data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 38 (#1)
Use of uninitialized value in concatenation (.) or string at
/data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 38 (#1)
Code:
[COLOR="Teal"][B][SIZE="4"]Error 2: SSAKE[/SIZE][/B][/COLOR] Running: /data3/users/arun/Apps/ssake_v3-8/SSAKE [v3.8] -f vfs_dev.HKCI5a.RPm.plus.vicinity.CS_FnR.ssake.in -s vfs_dev.HKCI5a.CSm.out.fullread.fa -i 0 -h 0 -w 1 -m 20 -o 3 -r 0.9 -t 0 -z 100 -p 1 -e 0.75 -k 4 -a 0.5 -x 20 Unpaired reads (optional) -g no-g Scaffolds: vfs_dev.HKCI5a.targeted.assembly.sensitive.scaffolds Merged contigs: vfs_dev.HKCI5a.targeted.assembly.sensitive.mergedcontigs Pairing issues: vfs_dev.HKCI5a.targeted.assembly.sensitive.pairing_issues Pairing distance distribution: vfs_dev.HKCI5a.targeted.assembly.sensitive.pairing_distribution.csv Contigs: vfs_dev.HKCI5a.targeted.assembly.sensitive.contigs Singlets: vfs_dev.HKCI5a.targeted.assembly.sensitive.singlets Excluded reads: vfs_dev.HKCI5a.targeted.assembly.sensitive.short Log: vfs_dev.HKCI5a.targeted.assembly.sensitive.log =>Reading sequences initiated Thu Jan 2 14:45:44 CST 2014 Sequence reads loaded: 616Input error at line #618: The sequence "0:" is not in the right format for paired-end reads -- Fatal Make sure your input is in the form (input sequences can be of variable lengths): >test GCTACGACTATGACATACAGT:GTAGATTGATCGCATGCACGCT Where : separates paired reads. Spaces, <<.>> or any characters other than A,C,G or T in your input file might have caused this error, including reads with Ns. mv: cannot stat `vfs_dev.HKCI5a_temp/*.targeted.*.contigs': No such file or directory Number of log files deleted: 0
Comment