Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • jdrum00
    Member
    • Dec 2009
    • 16

    #1

    Samtools fasta line length segfault, redux

    There's been at least one thread on this already, so I'm wondering if anyone has a handy shell script they could share for fixing .fa files with bad line lengths. In my particular case, I get this error from samtools faidx:

    [fai_build_core] different line length in sequence 'chr13'.

    ...when using our standard reference file, hsap_36.1_hg18.fa.

    I want to reformat this file rather than downloading some known-correct one, since I don't know exactly where our file came from and what differences there might be between it and another.

    The thread linked above has a snippet of BioPerl, but alas, I don't have that available on the server where I'm working. The last poster outlines an approach, but doesn't provide actual code.

    Hopefully I'm not being too lazy here by asking if someone's got such a script in their back pocket...I'm just a bit overwhelmed at the moment. I would love not to have to solve this particular problem from scratch, and I'm sure a solution posted here would be useful to others in the future. Thanks!
  • jdrum00
    Member
    • Dec 2009
    • 16

    #2
    Turns out that in my case it's actually a blank line that's causing the problem. I started wondering why the issue was coming up at all, given that awk says the longest line in the file is 70 characters long:

    awk '{ if (x < length()) x = length() } END { print x }' hsap_36.1_hg18.fa

    I thought surely it couldn't be complaining about short lines...so I looked for sub-70-character lines:

    awk 'length($0) < 70' hsap_36.1_hg18.fa

    I got the expected set of header lines, and one trailing incomplete line per header block. But the last line of the chr13 block was blank due to the actual final line of sequence being exactly 70 characters.

    So the brute-force solution for me is just to eliminate blank lines from the file:

    grep . hsap_36.1_hg18.fa > tmp; mv tmp hsap_36.1_hg18.fa

    This still leaves the questions of (1) why samtools can't handle a simple silly blank line and (2) how to fold a FASTA file that does have anomalous line lengths...but my immediate crisis is over. Thanks in advance, though, for any insights anyone has on either of those questions!

    Comment

    • saad0105050
      Junior Member
      • Apr 2012
      • 5

      #3
      Thanks.

      I did this:
      Code:
      awk '(NF!=0){print}' sample.fa>tmp.fa
      awk '(NF==0){print "\blank"}' tmp.fa # check
      mv tmp.fa sample.fa

      Comment

      • jdrum00
        Member
        • Dec 2009
        • 16

        #4
        That works too. But there are canned answers to this sort of question nowadays, fortunately, that didn't exist in 2009 when I originally posted. Picard, for example, has a FASTA-fixer:



        I suspect BioPerl and similar packages were doing this even in 2009, but I was pretty new to the field then and didn't know about them.

        Comment

        • saad0105050
          Junior Member
          • Apr 2012
          • 5

          #5
          In my case, the actual problem was different (I found out later).

          I extracted the genomic sequences from UCSC table browser in fasta format and saved it as my reference file. Invoking samtools faidx was giving the error 'different line length...'. However, fixing empty lines did not stop the error, and I discovered that my fasta file was truncated due to timeout while downloading from UCSC; the error message was the last lines of my fasta file and it was causing samtools emit this message.

          Comment

          • reubennowell
            Member
            • Jan 2013
            • 18

            #6
            I found another case where this was happening I thought I'd just add to the list for future reference.

            My input fasta file was line wrapped, and there was a blank line between sequences. The problem sequence was where coincidentally the seq ended exactly at the line wrap position, ie:

            Code:
            >not_a_problem_seq
            AATCGACGTACGTAGCTGATC
            ATCGATGCTAGCTATAATCGT
            ACTAGCTACTGG
            
            >problem_seq
            ACTGCTAGCTGATCGATCGTAG
            ACGTACGTAGCTAGCTGACTGA
            ACTGATCGTAGCTAGCTGATCG <- here!
            
            >next_seq
            ATCGACGTAGCTAGCTAGCTAT
            ACTGATGCTACTAGCTGATGCT
            ACTGA
            Issue was resolved by actually adding an extra blank line between the end of problem_seq and the header for next_seq.

            Comment

            • jmarshall
              Samtools maintainer
              • Jul 2009
              • 39

              #7
              Originally posted by reubennowell View Post
              My input fasta file was line wrapped, and there was a blank line between sequences. The problem sequence was where coincidentally the seq ended exactly at the line wrap position
              Thanks for reporting this. I've now fixed it and the fix will appear in samtools (and htslib) 1.3.

              Comment

              Latest Articles

              Collapse

              • SEQadmin2
                Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                by SEQadmin2



                CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                Despite this, “CRISPR helped turn genome editing from a specialized technique into
                ...
                07-31-2026, 11:01 AM
              • SEQadmin2
                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                by SEQadmin2


                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                The systematic characterization of the human proteome has
                ...
                07-20-2026, 11:48 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, 08-06-2026, 07:41 AM
              0 responses
              14 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 08-03-2026, 10:13 AM
              0 responses
              31 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-31-2026, 02:55 AM
              0 responses
              40 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-24-2026, 12:17 PM
              0 responses
              26 views
              0 reactions
              Last Post SEQadmin2  
              Working...