[OTU]

Through yum - got success! Thank you!
And with libz2:
[root@localhost Ray-v2.2.0]# file -L /usr/lib64/libbz2.so
/usr/lib64/libbz2.so: ELF 64-bit LSB shared object, x86-64, version 1 (SYSV), dynamically linked, BuildID[sha1]=0x7705fc6fbd1d6aa0ffde9b4f54189a5b637e3ee0, stripped

Is this ok?

[seb567]

Through yum - got success! Thank you!
And with libz2:
[root@localhost Ray-v2.2.0]# file -L /usr/lib64/libbz2.so
/usr/lib64/libbz2.so: ELF 64-bit LSB shared object, x86-64, version 1 (SYSV), dynamically linked, BuildID[sha1]=0x7705fc6fbd1d6aa0ffde9b4f54189a5b637e3ee0, stripped

Is this ok?

The package you installed with yum is 2.1.0-6.fc19 (not 2.2.0).


So if you also want 2.2.0, can you try this (with gz support but without bz2 support):


make clean
make HAVE_LIBZ=y HAVE_LIBBZ2=n

[OTU]

Em....

And after this, what should I do? Does this mean the end of installation of Ray-v2.2.0?
I am sorry, I am just confused with all this stuff...

[seb567]

Em....

And after this, what should I do? Does this mean the end of installation of Ray-v2.2.0?
I am sorry, I am just confused with all this stuff...

No. The command above is to build Ray with gz support but no bz2 support.


Did you try:

make clean
make HAVE_LIBZ=y HAVE_LIBBZ2=n

[Brian E]

So, to add to an already massive thread, it's looking like Ray is going to be the assembler we're going to be using for our Metagenome work, and I was wondering if it is possible to obtain the location that each read ends up in the assembly. We're using multiple biological replicates, sequenced separately (multiplexed) and we know that there is some variation in the abundance of the organisms that are present in the community. What I would like is the contribution of each individual sample to the local coverage of the whole assembly. I think this could help with pulling out individual genomes.
I know could get at this by mapping with e.g. Bowtie, but if it is possible to keep track of where these reads are ending up, it would save a significant amount of time on our computer cluster allocation. Is this possible?

[seb567]

So, to add to an already massive thread, it's looking like Ray is going to be the assembler we're going to be using for our Metagenome work,

There is a thread for Ray Meta (Ray for Metagenomics):

http://seqanswers.com/forums/showthread.php?t=26278

Paper: http://genomebiology.com/2012/13/12/R122

and I was wondering if it is possible to obtain the location that each read ends up in the assembly.

There is the -amos option, but on the mailing list, I see more people relying on post-assembly read mapping onto the contigs.

We're using multiple biological replicates, sequenced separately (multiplexed) and we know that there is some variation in the abundance of the organisms that are present in the community. What I would like is the contribution of each individual sample to the local coverage of the whole assembly. I think this could help with pulling out individual genomes.

If you are sequencing barcoded samples, then demultiplexing should be done before feeding the data to Ray.

I know could get at this by mapping with e.g. Bowtie, but if it is possible to keep track of where these reads are ending up, it would save a significant amount of time on our computer cluster allocation. Is this possible?

As stated above, Ray can generate an AMOS file, which contains read usage.

Séb

[bossanova352]

I'm trying to use Ray on some environmental metagenomes, but every time I set up a run, the output contig and scaffold files are empty. I haven't seen any indication during the assembly run, and all sequences are recognized by Ray. One possibility that comes to mind is from some errors that came up while compiling. Specifically, when trying to use the make install command, an error pops up saying there is no README file in ray-build/RayPlatform. If I place the README file in RayPlatform and try again, I get an error saying there is already a file named RayPlatform.

Edit: After reinstalling Ray with the developer package, there are no installation errors. As of now, I'm stumped why there are no assembled sequences in either of the output Contigs.fasta or Scaffolds.fasta files.

[VidJa]

I'm trying to use Ray with a mix of Illumina SE and 454 data using the -amos
mpiexec -n 10 Ray -s illumina.fasta -s 454.fasta -k 31 -amos -o mix
454 reads have an avg length of 396bp and the illumina reads are 60bp

The resulting amos file AMOS.afg can be browsed using Tablet, but I noticed that the original read names are converted to just a number and thus making it impossible to easily trace which reads end up in a particular contig. Is it possible to save the original readnames in the AMOS output?

[seb567]

I'm trying to use Ray on some environmental metagenomes, but every time I set up a run, the output contig and scaffold files are empty. I haven't seen any indication during the assembly run, and all sequences are recognized by Ray. One possibility that comes to mind is from some errors that came up while compiling. Specifically, when trying to use the make install command, an error pops up saying there is no README file in ray-build/RayPlatform. If I place the README file in RayPlatform and try again, I get an error saying there is already a file named RayPlatform.

Edit: After reinstalling Ray with the developer package, there are no installation errors. As of now, I'm stumped why there are no assembled sequences in either of the output Contigs.fasta or Scaffolds.fasta files.

What is the content of RayOutput/NumberOfSequences.txt ?

Do you have any error in your standard output file ? ("grep Error log.stdout")

[seb567]

I'm trying to use Ray with a mix of Illumina SE and 454 data using the -amos
mpiexec -n 10 Ray -s illumina.fasta -s 454.fasta -k 31 -amos -o mix
454 reads have an avg length of 396bp and the illumina reads are 60bp

The resulting amos file AMOS.afg can be browsed using Tablet, but I noticed that the original read names are converted to just a number and thus making it impossible to easily trace which reads end up in a particular contig. Is it possible to save the original readnames in the AMOS output?

This is not currently possible because Ray does not read or store read names at all.

[bossanova352]

What is the content of RayOutput/NumberOfSequences.txt ?

Do you have any error in your standard output file ? ("grep Error log.stdout")

The output of NumberOfSequences.txt is:

Files: 1

FileNumber: 0
FilePath: ../SFBloom_paired_trimmed_1.fa
NumberOfSequences: 7917760
FirstSequence: 0
LastSequence: 7917759

Summary
NumberOfSequences: 7917760
FirstSequence: 0
LastSequence: 7917759

This is what I find in the stdoutput file a considerable way through. I think the issue lies in what I've quoted below, as there are seeds before this and everything goes to 0 afterwards. It looks like it's skipping all paths because of short length:

Rank 8 has 0 seeds
Rank 8 is creating seeds [147526/147526] (completed)
Rank 8: peak number of workers: 1887, maximum: 32768
Rank 8 : VirtualCommunicator (service provided by VirtualCommunicator): 494068 virtual messages generated 4040 real messages (0.817701%)
Rank 8 runtime statistics for seeding algorithm:
Rank 8 Skipped paths because of dead end for head: 0
Rank 8 Skipped paths because of dead end for tail: 0
Rank 8 Skipped paths because of two dead ends: 0
Rank 8 Skipped paths because of bubble weak component: 0
Rank 8 Skipped paths because of short length: 147526
Rank 8 Skipped paths because of bad ownership: 0
Rank 8 Skipped paths because of low coverage: 0
Rank 8 Eligible paths: 0
Rank 8: assembler memory usage: 139120 KiB

I'm working with Illumina Hiseq paired end 100 bp reads which have been trimmed based on quality scores and length, so there should be nothing shorter than 50 bp. Oh, and my command is this:

mpiexec -n 10 Ray -k 57 -i ../SFBloom_paired_trimmed_1.fa -o RayOutputTest

[seb567]

The output of NumberOfSequences.txt is:



This is what I find in the stdoutput file a considerable way through. I think the issue lies in what I've quoted below, as there are seeds before this and everything goes to 0 afterwards. It looks like it's skipping all paths because of short length:



I'm working with Illumina Hiseq paired end 100 bp reads which have been trimmed based on quality scores and length, so there should be nothing shorter than 50 bp. Oh, and my command is this:

mpiexec -n 10 Ray -k 57 -i ../SFBloom_paired_trimmed_1.fa -o RayOutputTest

Can you paste the 10 first lines of your file named SFBloom_paired_trimmed_1.fa ?

[bossanova352]

Can you paste the 10 first lines of your file named SFBloom_paired_trimmed_1.fa ?

Yeah, here it is:

>DB775P1:2451TDYACXX:2:1101:1582:1958_1:N:0:CGTACTAG
ATAATCGTTTGCTCGGCTATTTGAGTTGCAGATATTAATTGTTTACGACGGGATGTATCA
AGTTCTGCAAAGACATCATCCAAAATTAGAATGGGTTC
>DB775P1:2451TDYACXX:2:1101:1582:1958_2:N:0:CGTACTAG
ATGACCTACATCTACAAATCGGAGATTTTCCGGCTAAAGGTTATGCCAGCCACGGTGAAT
CCTGGTCAATGGCGATTTCACTACGCATTGGATCTTTTAAT
>DB775P1:2451TDYACXX:2:1101:1853:1966_1:N:0:CGTACTAG
TTCACCTAGAGAATGACCGGCAACAAAGTGGGGCGTAGGAAGTCGATCCTTGAAAGAGGT
GAGGACCATCCAGGAGTGCATTAAAATAGCCGGCTGAG
>DB775P1:2451TDYACXX:2:1101:1853:1966_2:N:0:CGTACTAG

[seb567]

Yeah, here it is:

Each sequence needs to be on one line (this is a current limitation of fasta support in Ray).

That's presumably the issue.

[bossanova352]

Each sequence needs to be on one line (this is a current limitation of fasta support in Ray).

That's presumably the issue.

How silly of me! Well I changed the formatting, but unfortunately I'm still not getting any output from Ray. This is what the file looks like now (all sequences on one line):

>DB775P1:2451TDYACXX:2:1101:1582:1958_1:N:0:CGTACTAG
AGTTCTGCAAAGACATCATCCAAAATTAGAATGGGTTCTTGTTTACGACGGGATGTATCA
>DB775P1:2451TDYACXX:2:1101:1582:1958_2:N:0:CGTACTAG
CCTGGTCAATGGCGATTTCACTACGCATTGGATCTTTTAATTATGCCAGCCACGGTGAAT
>DB775P1:2451TDYACXX:2:1101:1853:1966_1:N:0:CGTACTAG
GAGGACCATCCAGGAGTGCATTAAAATAGCCGGCTGAGGAAGTCGATCCTTGAAAGAGGT
>DB775P1:2451TDYACXX:2:1101:1853:1966_2:N:0:CGTACTAG
GTCAAGAATGCCATCCGAGCTGCGATGACCAATATCGAGCAAAGTAGCGATGCCCGCGCT
>DB775P1:2451TDYACXX:2:1101:2768:1957_1:N:0:CGTACTAG
GTTGGAGCGCTTGGTATCCTGCGCTCCAATATTCATCACAGTGGGAATGACGCCCCCTAC

Again, it looks like this step has some clues as to what is going on:

Rank 2 has 12675 seeds
Rank 2 is creating seeds [2985784/2985784] (completed)
Rank 2: peak number of workers: 2002, maximum: 32768
Rank 2 : VirtualCommunicator (service provided by VirtualCommunicator): 19245610
Rank 2 runtime statistics for seeding algorithm:
Rank 2 Skipped paths because of dead end for head: 0
Rank 2 Skipped paths because of dead end for tail: 0
Rank 2 Skipped paths because of two dead ends: 0
Rank 2 Skipped paths because of bubble weak component: 0
Rank 2 Skipped paths because of short length: 2960369
Rank 2 Skipped paths because of bad ownership: 12740
Rank 2 Skipped paths because of low coverage: 0
Rank 2 Eligible paths: 12675
Rank 2: assembler memory usage: 263224 KiB

Fixed! It was another formatting issue, (^M characters were showing up after the one-line formatting). Thanks, Seb! I appreciate the help.