[quinlana]

Maasha,
This looks really promising! I'd be keen to see examples for creating biopieces with C++ and/or Python. I'm looking forward to slicing and dicing with biopieces, samtools, BEDTools, and EMBOSS. As ohoffman states, we may soon be close to a simple, well-documented shell for our day to day sausage grinding.

Keep it rolling!
Aaron

[maasha]

@Aaron

The creation of new Biopieces is intended to be super easy! For now I only have documented how to create Biopieces in Perl as described here. Each Biopiece's "usage" information is written in Google's wiki format, and a specific Biopiece print_wiki renders the usage information nicely in console, and thus the usage information is independent of the programming language.

Unfortunately, I am not very strong in Ruby and C, also my Python and C++ is non-existent. Having said this, there do exists one Biopiece written in Python: lowercase_seq. You can browse the code here: http://code.google.com/p/biopieces/s...e_python/Cjung

I hope it is pretty self-explanatory to Python coders. I would love to have this polished and then add a "Howto create a Biopiece using Python" section to the docs.

[maasha]

Biopieces -> now in Ruby

I am glad to announce, that I finally got around to writing the first Biopieces (www.biopieces.org) using Ruby (http://www.ruby-lang.org/en/). I have managed to setup a way of writing Biopieces in Ruby that is more compact and robust compared to the Perl way. Biopiece record serialization (the parsing and emitting of records), option parsing and checking, record integrity checking, logging, and error handling is all abstracted away form the main code to the 'Biopieces' class. Thus a minimalistic Biopiece consists of code like this - and nothing more!:

require 'biopieces'

casts = []
casts << {:long=>'compress',:short=>'Z',:type=>'flag',:mandatory=>false,:default=>nil,:allowed=>nil,:disallowed=>nil}

bp = Biopieces.new

options = bp.parse(ARGV,casts)

bp.mktmpdir # create an optional temporary directory that is auto deleted.

bp.each_record do |record|
  # do something to each record (possibly according to the options). e.g.:
  record["SEQ"].upcase! if record.has_key? "SEQ"
  bp.puts record
end

Read more here: http://code.google.com/p/biopieces/w...ece_using_Ruby



Cheers,



Martin

[Fatallis]

Hello I'm working with small RNAs expressed in Glycine max. And I tried to install biopieces but I get stucked on the final part: the ~/.bashrc configuration and the creation of $BP_DATA, $BP_TMP, and $BP_LOG directories, when I use the mkdir command it says and opperand is missing.

I wonder if the sequences can be mapped against other than human genomes using biopieces.

I'm sorry if its not the right place to ask help, but I appreciate you help and thanks to Martin for sharing these tools.

[maasha]

Sure Biopieces can be used to analyze other genomes. Currently, I am only working with prokaryotes, but I have been working on human, mouse, drosophila, and yeast.

The "mapping" Biopieces mostly have an "indexing" Biopieces:

read_fasta -i test.fna | create_bowtie_index -d my_dir -i my_index -x
read_fasta -i test.fna | create_bwa_index -d my_dir -i my_index -x
read_fasta -i test.fna | create_blast_index -d my_dir -i my_index -x
read_fasta -i test.fna | create_vmatch_index -d my_dir -i my_index -x

etc ...

And then a "search" Biopiece:

read_fasta -i query.fna | bowtie_seq -i my_dir/my_index | write_bed -x
read_fasta -i query.fna | bwa_seq -i my_dir/my_index | write_bed -x
read_fasta -i query.fna | blast_seq -i my_dir/my_index | write_bed -x
read_fasta -i query.fna | vmatch_seq -i my_dir/my_index | write_bed -x

etc ...

There is also a Biopiece to format a file tree structure with indexes:

format_genome

And a Biopiece to show what genomes have been formatted:

list_genomes

These allow shortcuts to "search" Biopieces so you can use -g <my_genome> instead of -i <path_to_index>.

For your specific problems with installation I need more details - like a copy paste of the exact error. Possibly you need to run source ~/.bashrc before mkdir $BP_DATA $BP_TMP $BP_LOG. The right forum for support would be the Biopieces Google Group:

http://groups.google.com/group/biopieces

You need to apply for membership because I have had problems with @#%#$^ spammers.


Cheers,



Martin

[Fatallis]

Thank you I ran source ~/.bashrc and everything went ok.

I'm signing in on the Biopieces group..

[fabrice]

I have took 2 hours to install biopieces and fail.

I think biopieces is too hard to install. The big problem is I do not know ruby and how to install gem and so on.

read_fasta
<internal:lib/rubygems/custom_require>:29:in `require': no such file to load -- rubygems (LoadError)
from <internal:lib/rubygems/custom_require>:29:in `require'
from <internal:gem_prelude>:167:in `load_full_rubygems_library'
from <internal:gem_prelude>:217:in `try_activate'
from <internal:lib/rubygems/custom_require>:32:in `rescue in require'
from <internal:lib/rubygems/custom_require>:29:in `require'
from /env/ceph/home/jhuang/bin/biopieces/code_ruby/lib/maasha/biopieces.rb:27:in `<top (required)>'
from <internal:lib/rubygems/custom_require>:29:in `require'
from <internal:lib/rubygems/custom_require>:29:in `require'
from ~/bin/biopieces/bp_bin/read_fasta:31:in `<main>'




bp_test
Testing Perl version ... OK
Testing required Perl module - "Inline": FAIL
Try: perl -MCPAN -e 'install Inline'

www.biopieces.org

The Biopieces are a collection of bioinformatics tools that can be pieced together in a very easy and flexible manner to perform both simple and complex tasks. The Biopieces work on a data stream in such a way that the data stream can be passed through several different Biopieces, each performing one specific task: modifying or adding records to the data stream, creating plots, or uploading data to databases and web services. The Biopieces are executed in a command line environment where the data stream is initialized by specific Biopieces which read data from files, databases, or web services, and output records to the data stream that is passed to downstream Biopieces until the data stream is terminated at the end of the analysis as outlined below:

read_data | calculate_something | write_results

The following example demonstrates how a Solexa deep sequencing experiment can be analyzed – including removal of adaptor sequence, determining the number of unique sequences, mapping to a specified genome, and uploading the data to the UCSC genome browser for further analysis:

read_solexa –i data.solexa |              #  Initialize data stream from a file. 
remove_adaptor -a TCGTATGCC -m 2 |        #  Remove adaptor sequence allowing for 2 mismatches. 
grab –e ‘ADAPTOR_POS > -1’ |              #  Get all entries where an adaptor sequence was found. 
count_vals –k SEQ |                       #  Determine the occurrences of all sequences.  
uniq_vals –k SEQ |                        #  Get all entries with a unique sequence. 
merge_vals –k SEQ_NAME,SEQ_COUNT |        #  Append the sequence count to the sequence name. 
vmatch_seq –g hg18 |                      #  Map the sequences to the Human genome using Vmatch. 
upload_to_ucsc –d hg18 –t solexa_data –x  #  Upload the mapping results to the UCSC Genome Browser.

The advantage of the Biopieces is that a user can easily solve simple and complex tasks without having any programming experience. Moreover, since the data format used to pass data between Biopieces is text based, different developers can quickly create new Biopieces in their favorite programming language - and all the Biopieces will maintain compatibility.

There are currently ~140 Biopieces.

[maasha]

@fabrice

I have tried to make the installation of Biopieces as painless as possible. The installation procedure is described here:

http://code.google.com/p/biopieces/wiki/Installation

If you follow this step-by-step the installation should be done with in a couple of minutes. I am very open to suggestions on how to improve this procedure.

I see that you have run bp_test - which is good. Now, do as bp_test suggests:

Try: perl -MCPAN -e 'install Inline'

Mind you that it is not really an option to write an installer since this would have to deal with the installation of Perl, Ruby, Python, and required modules as well as a bunch of 3rd party tools ...

Cheers,


Martin

[fabrice]

bp_test
Testing Perl version ... OK
Testing required Perl module - "Inline": OK
Testing required Perl module - "JSON::XS": OK
Testing required Perl module - "SVG": OK
Testing required Perl module - "Bit::Vector": OK
Testing required Perl module - "Time::HiRes": OK
Testing Ruby version ... OK
Testing required Ruby gem - "gnuplot": `~/bin/biopieces/bp_test/lib/test.sh: line 160: gem: command not found
FAIL
Try: gem install gnuplot

Install a bunch of 3rd party tools is pain.

@fabrice

I have tried to make the installation of Biopieces as painless as possible. The installation procedure is described here:

http://code.google.com/p/biopieces/wiki/Installation

If you follow this step-by-step the installation should be done with in a couple of minutes. I am very open to suggestions on how to improve this procedure.

I see that you have run bp_test - which is good. Now, do as bp_test suggests:




Mind you that it is not really an option to write an installer since this would have to deal with the installation of Perl, Ruby, Python, and required modules as well as a bunch of 3rd party tools ...

Cheers,


Martin

[fabrice]

gem install gnuplot
-bash: gem: command not found

When I download rubygems-1.8.7 and try to install. There are problem.
bin/ruby/rubygems-1.8.7$ ruby setup.rb
Segmentation fault


bp_test
Testing Perl version ... OK
Testing required Perl module - "Inline": OK
Testing required Perl module - "JSON::XS": OK
Testing required Perl module - "SVG": OK
Testing required Perl module - "Bit::Vector": OK
Testing required Perl module - "Time::HiRes": OK
Testing Ruby version ... OK
Testing required Ruby gem - "gnuplot": OK
Testing required Ruby gem - "narray": FAIL
Try: gem install narray



gem install narray
Building native extensions. This could take a while...
sh: line 1: 17222 Segmentation fault ~/bin/ruby/bin/ruby extconf.rb 2>&1
ERROR: Error installing narray:
ERROR: Failed to build gem native extension.

~/bin/ruby/bin/ruby extconf.rb


Gem files will remain installed in ~/bin/ruby/lib/ruby/gems/1.9.1/gems/narray-0.5.9.9 for inspection.
Results logged to ~/bin/ruby/lib/ruby/gems/1.9.1/gems/narray-0.5.9.9/src/gem_make.out

[maasha]

@fabrice,

Ruby comes with a number of tools including a program called "gem" for installing third party modules. Your "gem" program does not appear to be in path. That is an issue with your Ruby installation. You can manually locate the "gem" program and add to $PATH.


Cheers,


Martin

[fabrice]

When I download rubygems-1.8.7 and try to install. There are problem.
bin/ruby/rubygems-1.8.7$ ruby setup.rb
Segmentation fault

So I just set ~/bin/ruby/rubygems-1.8.7/bin into the $PATH. Now for install gnuplot is OK. But for narray, it no.

bp_test
Testing Perl version ... OK
Testing required Perl module - "Inline": OK
Testing required Perl module - "JSON::XS": OK
Testing required Perl module - "SVG": OK
Testing required Perl module - "Bit::Vector": OK
Testing required Perl module - "Time::HiRes": OK
Testing Ruby version ... OK
Testing required Ruby gem - "gnuplot": OK
Testing required Ruby gem - "narray": FAIL
Try: gem install narray



gem install narray
Building native extensions. This could take a while...
sh: line 1: 17222 Segmentation fault ~/bin/ruby/bin/ruby extconf.rb 2>&1
ERROR: Error installing narray:
ERROR: Failed to build gem native extension.

~/bin/ruby/bin/ruby extconf.rb


Gem files will remain installed in ~/bin/ruby/lib/ruby/gems/1.9.1/gems/narray-0.5.9.9 for inspection.
Results logged to ~/bin/ruby/lib/ruby/gems/1.9.1/gems/narray-0.5.9.9/src/gem_make.out

@fabrice,

Ruby comes with a number of tools including a program called "gem" for installing third party modules. Your "gem" program does not appear to be in path. That is an issue with your Ruby installation. You can manually locate the "gem" program and add to $PATH.


Cheers,


Martin

[maasha]

It appears that you are mixing two versions of Ruby -> 1.8.7 and a 1.9.x version. We need the 1.9.x one. You don't have to download rubygem - it comes with Ruby 1.9.x. What do the following commands give?

which ruby
ruby --version
which gem
gem --version



Cheers


Martin

[fabrice]

Testing Perl version ... OK
Testing required Perl module - "Inline": OK
Testing required Perl module - "JSON::XS": OK
Testing required Perl module - "SVG": OK
Testing required Perl module - "Bit::Vector": OK
Testing required Perl module - "Time::HiRes": OK
Testing Ruby version ... OK
Testing required Ruby gem - "gnuplot": OK
Testing required Ruby gem - "narray": OK
Testing auxiliary program - "blastall": WARNING
Testing auxiliary program - "blat": OK
Testing auxiliary program - "bwa": OK
Testing auxiliary program - "bowtie": OK
Testing auxiliary program - "formatdb": WARNING
Testing auxiliary program - "gnuplot": OK
Testing auxiliary program - "idba": WARNING
Testing auxiliary program - "muscle": WARNING
Testing auxiliary program - "mummer": WARNING
Testing auxiliary program - "mysql": OK
Testing auxiliary program - "prodigal": WARNING
Testing auxiliary program - "Ray": WARNING
Testing auxiliary program - "scan_for_matches": WARNING
Testing auxiliary program - "uclust": WARNING
Testing auxiliary program - "velveth": WARNING
Testing auxiliary program - "velvetg": WARNING
Testing auxiliary program - "vmatch": WARNING
Testing add_ident -I $BP_DIR/bp_test/in/add_ident.in -O $BP_TMP/add_ident.out ... OK
Testing add_ident -I $BP_DIR/bp_test/in/add_ident.in -k CUSTOM_KEY -O $BP_TMP/add_ident.out ... OK
Testing add_ident -I $BP_DIR/bp_test/in/add_ident.in -p PREFIX -O $BP_TMP/add_ident.out ... OK
Testing add_ident -I $BP_DIR/bp_test/in/add_ident.in -o 5 -O $BP_TMP/add_ident.out ... OK
Testing align_seq -I $BP_DIR/bp_test/in/align_seq.in -O $BP_TMP/align_seq.out ... FAIL
Testing analyze_assembly -I $BP_DIR/bp_test/in/analyze_assembly.in -O $BP_TMP/analyze_assembly.out ... OK
Testing analyze_assembly -I $BP_DIR/bp_test/in/analyze_assembly.in -o $BP_TMP/analyze_assembly.out -x ... OK
Testing analyze_gc -I $BP_DIR/bp_test/in/analyze_gc.in -O $BP_TMP/analyze_gc.out ... OK
Testing analyze_seq -I $BP_DIR/bp_test/in/analyze_seq.in -O $BP_TMP/analyze_seq.out ... OK
Testing analyze_vals -I $BP_DIR/bp_test/in/analyze_vals.in -o $BP_TMP/analyze_vals.out -x ... OK
Testing analyze_vals -I $BP_DIR/bp_test/in/analyze_vals.in -k V0 -o $BP_TMP/analyze_vals.out -x ... OK
Testing analyze_vals -I $BP_DIR/bp_test/in/analyze_vals.in -K V0 -o $BP_TMP/analyze_vals.out -x ... OK
Testing bin_vals -I $BP_DIR/bp_test/in/bin_vals.in -k V0 -O $BP_TMP/bin_vals.out ... OK
Testing bin_vals -I $BP_DIR/bp_test/in/bin_vals.in -k V0 -b 5 -O $BP_TMP/bin_vals.out ... OK
Testing blast_seq -I $BP_DIR/bp_test/in/blast_seq.in.2 -d $BP_TMP/test_tmp/nucleotide -O $BP_TMP/blast_seq.out ... FAIL
Testing blast_seq -I $BP_DIR/bp_test/in/blast_seq.in.2 -d $BP_TMP/test_tmp/protein -O $BP_TMP/blast_seq.out ... FAIL
Testing blast_seq -I $BP_DIR/bp_test/in/blast_seq.in.4 -d $BP_TMP/test_tmp/nucleotide -O $BP_TMP/blast_seq.out ... FAIL
Testing blast_seq -I $BP_DIR/bp_test/in/blast_seq.in.4 -d $BP_TMP/test_tmp/protein -O $BP_TMP/blast_seq.out ... FAIL
Testing blast_seq -I $BP_DIR/bp_test/in/blast_seq.in.2 -d $BP_TMP/test_tmp/nucleotide -p tblastx -O $BP_TMP/blast_seq.out ... FAIL
Testing blast_seq_pair -I $BP_DIR/bp_test/in/blast_seq_pair.in.1 -O $BP_TMP/blast_seq_pair.out ... FAIL
Testing blast_seq_pair -I $BP_DIR/bp_test/in/blast_seq_pair.in.2 -O $BP_TMP/blast_seq_pair.out ... FAIL
Testing blast_seq_pair -I $BP_DIR/bp_test/in/blast_seq_pair.in.3 -O $BP_TMP/blast_seq_pair.out ... FAIL
Testing blast_seq_pair -I $BP_DIR/bp_test/in/blast_seq_pair.in.4 -O $BP_TMP/blast_seq_pair.out ... FAIL
Testing blast_seq_pair -I $BP_DIR/bp_test/in/blast_seq_pair.in.1 -p tblastx -O $BP_TMP/blast_seq_pair.out ... FAIL
Testing calc_N50 -I $BP_DIR/bp_test/in/calc_N50.in -O $BP_TMP/calc_N50.out ... OK
Testing calc_N50 -I $BP_DIR/bp_test/in/calc_N50.in -o $BP_TMP/calc_N50.out -x ... OK
Testing calc_bit_scores -I $BP_DIR/bp_test/in/calc_bit_scores.in -O $BP_TMP/calc_bit_scores.out ... OK
Testing cat_seq -I $BP_DIR/bp_test/in/cat_seq.in -O $BP_TMP/cat_seq.out ... OK
Testing cat_seq -I $BP_DIR/bp_test/in/cat_seq.in -x -O $BP_TMP/cat_seq.out ... OK
Testing cat_seq -I $BP_DIR/bp_test/in/cat_seq.in -s Foobar -O $BP_TMP/cat_seq.out ... OK
Testing clip_adaptor -I $BP_DIR/bp_test/in/clip_adaptor.in -O $BP_TMP/clip_adaptor.out ... OK
Testing clip_seq -I $BP_DIR/bp_test/in/clip_seq.in -O $BP_TMP/clip_seq.out ... OK
Testing complement_seq -I $BP_DIR/bp_test/in/complement_seq.in -O $BP_TMP/complement_seq.out ... OK
Testing create_blast_index -I $BP_DIR/bp_test/in/create_blast_index.in.1 -d $BP_TMP/test_tmp -i 'index' -x ... FAIL
Testing create_blast_index -I $BP_DIR/bp_test/in/create_blast_index.in.2 -d $BP_TMP/test_tmp -i 'index' -x ... FAIL
Testing digest_seq -p GGATCC -c 1 -I $BP_DIR/bp_test/in/digest_seq.in -O $BP_TMP/digest_seq.out ... OK
Testing digest_seq -p GGACTT -c 1 -I $BP_DIR/bp_test/in/digest_seq.in -O $BP_TMP/digest_seq.out ... OK
Testing digest_seq -p GGATCC -c 1000 -I $BP_DIR/bp_test/in/digest_seq.in -O $BP_TMP/digest_seq.out ... OK
Testing digest_seq -p GGATCC -c -1000 -I $BP_DIR/bp_test/in/digest_seq.in -O $BP_TMP/digest_seq.out ... OK
Testing find_adaptor -a TCGTATGCCGTCTTCTGCTTG -m 0 -i 0 -d 0 -I $BP_DIR/bp_test/in/find_adaptor.in -O $BP_TMP/find_adaptor.out ... FAIL
Testing find_adaptor -a TCGTATGCCGTCTTCTGCTTG -m 0 -i 0 -d 0 -p -l 5 -I $BP_DIR/bp_test/in/find_adaptor.in -O $BP_TMP/find_adaptor.out ... FAIL
Testing find_adaptor -a TCGTATGCCGTCTTCTGCTTG -m 10 -i 0 -d 0 -I $BP_DIR/bp_test/in/find_adaptor.in -O $BP_TMP/find_adaptor.out ... FAIL
Testing find_adaptor -a TCGTATGCCGTCTTCTGCTTG -m 0 -i 10 -d 0 -I $BP_DIR/bp_test/in/find_adaptor.in -O $BP_TMP/find_adaptor.out ... FAIL
Testing find_adaptor -a TCGTATGCCGTCTTCTGCTTG -m 0 -i 0 -d 10 -I $BP_DIR/bp_test/in/find_adaptor.in -O $BP_TMP/find_adaptor.out ... FAIL
Testing find_gaps -I $BP_DIR/bp_test/in/find_gaps.in -O $BP_TMP/find_gaps.out ... OK
Testing find_gaps -I $BP_DIR/bp_test/in/find_gaps.in -m 3 -O $BP_TMP/find_gaps.out ... OK
Testing find_homopolymers -I $BP_DIR/bp_test/in/find_homopolymers.in -O $BP_TMP/find_homopolymers.out ... OK
Testing find_homopolymers -I $BP_DIR/bp_test/in/find_homopolymers.in -m 3 -O $BP_TMP/find_homopolymers.out ... OK
Testing find_mids -I $BP_DIR/bp_test/in/find_mids.in.1 -p 4 -O $BP_TMP/find_mids.out ... OK
Testing find_mids -I $BP_DIR/bp_test/in/find_mids.in.2 -O $BP_TMP/find_mids.out ... OK
Testing grab -I $BP_DIR/bp_test/in/grab.in -p SEQ -O $BP_TMP/grab.out ... OK
Testing grab -I $BP_DIR/bp_test/in/grab.in -p SEQ,COUNT -O $BP_TMP/grab.out ... OK
Testing grab -I $BP_DIR/bp_test/in/grab.in -P ~/bin/biopieces/bp_test/in/grab.in.pat -O $BP_TMP/grab.out ... OK
Testing grab -I $BP_DIR/bp_test/in/grab.in -p SEQ -i -O $BP_TMP/grab.out ... OK
Testing grab -I $BP_DIR/bp_test/in/grab.in -p SEQ -K -O $BP_TMP/grab.out ... OK
Testing grab -I $BP_DIR/bp_test/in/grab.in -p SEQ -V -O $BP_TMP/grab.out ... OK
Testing grab -I $BP_DIR/bp_test/in/grab.in -p SEQ -k PAT -O $BP_TMP/grab.out ... OK
Testing grab -I $BP_DIR/bp_test/in/grab.in -r a -k SEQ -O $BP_TMP/grab.out ... OK
Testing grab -I $BP_DIR/bp_test/in/grab.in -r a -k SEQ -c -O $BP_TMP/grab.out ... OK
Testing grab -I $BP_DIR/bp_test/in/grab.in -e 'SEQ_LEN<10' -O $BP_TMP/grab.out ... OK
Testing join_seq -I $BP_DIR/bp_test/in/join_seq.in -O $BP_TMP/join_seq.out ... OK
Testing kmer_freq -I $BP_DIR/bp_test/in/kmer_freq.in -O $BP_TMP/kmer_freq.out ... OK
Testing kmer_freq -I $BP_DIR/bp_test/in/kmer_freq.in -s 2 -O $BP_TMP/kmer_freq.out ... OK
Testing kmer_freq -I $BP_DIR/bp_test/in/kmer_freq.in -s 2 -t rna -O $BP_TMP/kmer_freq.out ... OK
Testing kmer_freq -I $BP_DIR/bp_test/in/kmer_freq.in -s 2 -t protein -O $BP_TMP/kmer_freq.out ... OK
Testing length_seq -I $BP_DIR/bp_test/in/length_seq.in -O $BP_TMP/length_seq.out ... OK
Testing length_vals -I $BP_DIR/bp_test/in/length_vals.in -k V0,V1 -O $BP_TMP/length_vals.out ... OK
Testing lowercase_seq -I $BP_DIR/bp_test/in/lowercase_seq.in -O $BP_TMP/lowercase_seq.out ... OK
Testing mask_seq -I $BP_DIR/bp_test/in/mask_seq.in -c 0 -O $BP_TMP/mask_seq.out ... OK
Testing max_vals -I $BP_DIR/bp_test/in/max_vals.in -k V1,V2 -o $BP_TMP/max_vals.out -x ... OK
Testing max_vals -I $BP_DIR/bp_test/in/max_vals.in -l V3 -O $BP_TMP/max_vals.out ... OK
Testing mean_scores -I $BP_DIR/bp_test/in/mean_scores.in -O $BP_TMP/mean_scores.out ... OK
Testing mean_scores -I $BP_DIR/bp_test/in/mean_scores.in -l -O $BP_TMP/mean_scores.out ... OK
Testing mean_scores -I $BP_DIR/bp_test/in/mean_scores.in -l -m 2 -O $BP_TMP/mean_scores.out ... OK
Testing mean_scores -I $BP_DIR/bp_test/in/mean_scores.in -l -m 2 -w 10 -O $BP_TMP/mean_scores.out ... OK
Testing mean_vals -I $BP_DIR/bp_test/in/mean_vals.in -k V1,V2 -o $BP_TMP/mean_vals.out -x ... OK
Testing mean_vals -I $BP_DIR/bp_test/in/mean_vals.in -l V3 -O $BP_TMP/mean_vals.out ... OK
Testing median_vals -I $BP_DIR/bp_test/in/median_vals.in -k V1,V2 -o $BP_TMP/median_vals.out -x ... OK
Testing median_vals -I $BP_DIR/bp_test/in/median_vals.in -l V3 -O $BP_TMP/median_vals.out ... OK
Testing min_vals -I $BP_DIR/bp_test/in/min_vals.in -k V1,V2 -o $BP_TMP/min_vals.out -x ... OK
Testing min_vals -I $BP_DIR/bp_test/in/min_vals.in -l V3 -O $BP_TMP/min_vals.out ... OK
Testing order_pairs -I $BP_DIR/bp_test/in/order_pairs.in -O $BP_TMP/order_pairs.out ... OK
Testing plot_distribution -k SEQ_LEN -I $BP_DIR/bp_test/in/plot_distribution.in -o $BP_TMP/plot_distribution.out -x ... FAIL
Testing read_454 -i $BP_DIR/bp_test/in/read_454.in -q ~/bin/biopieces/bp_test/in/read_454.in.qual -O $BP_TMP/read_454.out ... OK
Testing read_454 -i $BP_DIR/bp_test/in/read_454.in.gz -q ~/bin/biopieces/bp_test/in/read_454.in.qual.gz -O $BP_TMP/read_454.out ... OK
Testing read_454 -i $BP_DIR/bp_test/in/read_454.in -q ~/bin/biopieces/bp_test/in/read_454.in.qual -n 1 -O $BP_TMP/read_454.out ... OK
Testing read_blast_tab -i $BP_DIR/bp_test/in/read_blast_tab.in -O $BP_TMP/read_blast_tab.out ... OK
Testing read_blast_tab -i $BP_DIR/bp_test/in/read_blast_tab.in -n 1 -O $BP_TMP/read_blast_tab.out ... OK
Testing read_fasta -i $BP_DIR/bp_test/in/read_fasta.in -O $BP_TMP/read_fasta.out ... OK
Testing read_fasta -i $BP_DIR/bp_test/in/read_fasta.in.gz -O $BP_TMP/read_fasta.out ... OK
Testing read_fasta -i $BP_DIR/bp_test/in/read_fasta.in -n 1 -O $BP_TMP/read_fasta.out ... OK
Testing read_fastq -i $BP_DIR/bp_test/in/read_fastq.in -O $BP_TMP/read_fastq.out ... OK
Testing read_fastq -i $BP_DIR/bp_test/in/read_fastq.in.gz -O $BP_TMP/read_fastq.out ... OK
Testing read_fastq -i $BP_DIR/bp_test/in/read_fastq.in -n 1 -O $BP_TMP/read_fastq.out ... OK
Testing read_fastq -i $BP_DIR/bp_test/in/read_fastq.in -n 1 -s -O $BP_TMP/read_fastq.out ... OK
Testing read_genbank -i $BP_DIR/bp_test/in/read_genbank.in -O $BP_TMP/read_genbank.out ... OK
Testing read_genbank -i $BP_DIR/bp_test/in/read_genbank.in.gz -O $BP_TMP/read_genbank.out ... OK
Testing read_genbank -i $BP_DIR/bp_test/in/read_genbank.in -k AC -O $BP_TMP/read_genbank.out ... OK
Testing read_genbank -i $BP_DIR/bp_test/in/read_genbank.in -k AC -f CDS -O $BP_TMP/read_genbank.out ... OK
Testing read_genbank -i $BP_DIR/bp_test/in/read_genbank.in -k AC -f CDS -q translation -O $BP_TMP/read_genbank.out ... OK
Testing read_sff -i $BP_DIR/bp_test/in/read_sff.in -O $BP_TMP/read_sff.out ... OK
Testing read_sff -i $BP_DIR/bp_test/in/read_sff.in -n 1 -O $BP_TMP/read_sff.out ... OK
Testing read_sff -i $BP_DIR/bp_test/in/read_sff.in -n 1 -m -O $BP_TMP/read_sff.out ... OK
Testing read_sff -i $BP_DIR/bp_test/in/read_sff.in -n 1 -c -O $BP_TMP/read_sff.out ... OK
Testing read_solexa -i $BP_DIR/bp_test/in/read_solexa.in -O $BP_TMP/read_solexa.out ... OK
Testing read_solexa -i $BP_DIR/bp_test/in/read_solexa.in -n 1 -O $BP_TMP/read_solexa.out ... OK
Testing read_solexa -i $BP_DIR/bp_test/in/read_solexa.in -c -O $BP_TMP/read_solexa.out ... OK
Testing read_solexa -i $BP_DIR/bp_test/in/read_solexa.in -s -O $BP_TMP/read_solexa.out ... OK
Testing read_solexa -i $BP_DIR/bp_test/in/read_solexa.in -s -C 30 -O $BP_TMP/read_solexa.out ... OK
Testing read_tab -i $BP_DIR/bp_test/in/read_tab.in.1 -O $BP_TMP/read_tab.out ... OK
Testing read_tab -i $BP_DIR/bp_test/in/read_tab.in.1 -s 1 -O $BP_TMP/read_tab.out ... OK
Testing read_tab -i $BP_DIR/bp_test/in/read_tab.in.1 -s 1 -k ORGANISM,SEQ,COUNT -O $BP_TMP/read_tab.out ... OK
Testing read_tab -i $BP_DIR/bp_test/in/read_tab.in.1 -s 1 -c 2,1 -O $BP_TMP/read_tab.out ... OK
Testing read_tab -i $BP_DIR/bp_test/in/read_tab.in.1 -s 1 -c 2,1 -k COUNT,SEQ -O $BP_TMP/read_tab.out ... OK
Testing read_tab -i $BP_DIR/bp_test/in/read_tab.in.2 -O $BP_TMP/read_tab.out ... OK
Testing read_tab -i $BP_DIR/bp_test/in/read_tab.in.2 -n 1 -O $BP_TMP/read_tab.out ... OK
Testing read_tab -i $BP_DIR/bp_test/in/read_tab.in.3 -d ';' -O $BP_TMP/read_tab.out ... OK
Testing remove_indels -I $BP_DIR/bp_test/in/remove_indels.in -O $BP_TMP/remove_indels.out ... OK
Testing remove_keys -I $BP_DIR/bp_test/in/remove_keys.in -k SEQ_NAME,SEQ -O $BP_TMP/remove_keys.out ... OK
Testing remove_mids -I $BP_DIR/bp_test/in/remove_mids.in -O $BP_TMP/remove_mids.out ... OK
Testing remove_mids -I $BP_DIR/bp_test/in/remove_mids.in -p 4 -O $BP_TMP/remove_mids.out ... OK
Testing rename_keys -I $BP_DIR/bp_test/in/rename_keys.in -k SEQ,FOO -O $BP_TMP/rename_keys.out ... OK
Testing reverse_seq -I $BP_DIR/bp_test/in/reverse_seq.in -O $BP_TMP/reverse_seq.out ... OK
Testing scores_to_dec -I $BP_DIR/bp_test/in/scores_to_dec.in -O $BP_TMP/scores_to_dec.out ... OK
Testing shred_seq -I $BP_DIR/bp_test/in/shred_seq.in -s 18 -c 2 -O $BP_TMP/shred_seq.out ... OK
Testing sort_records -I $BP_DIR/bp_test/in/sort_records.in -k SEQ_LEN -O $BP_TMP/sort_records.out ... OK
Testing sort_records -I $BP_DIR/bp_test/in/sort_records.in -k SEQ_LENn -O $BP_TMP/sort_records.out ... OK
Testing sort_records -I $BP_DIR/bp_test/in/sort_records.in -k SEQ_LEN -r -O $BP_TMP/sort_records.out ... OK
Testing sum_vals -I $BP_DIR/bp_test/in/sum_vals.in -k V1,V2 -o $BP_TMP/sum_vals.out -x ... OK
Testing sum_vals -I $BP_DIR/bp_test/in/sum_vals.in -l V3 -O $BP_TMP/sum_vals.out ... OK
Testing swapcase_seq -I $BP_DIR/bp_test/in/swapcase_seq.in -O $BP_TMP/swapcase_seq.out ... OK
Testing translate_seq -I $BP_DIR/bp_test/in/translate_seq.in -O $BP_TMP/translate_seq.out ... OK
Testing translate_seq -I $BP_DIR/bp_test/in/translate_seq.in -f '1,-1' -O $BP_TMP/translate_seq.out ... OK
Testing transliterate_seq -I $BP_DIR/bp_test/in/transliterate_seq.in -s 'N' -r 'A' -O $BP_TMP/transliterate_seq.out ... OK
Testing transliterate_seq -I $BP_DIR/bp_test/in/transliterate_seq.in -d 'N' -O $BP_TMP/transliterate_seq.out ... OK
Testing transliterate_vals -I $BP_DIR/bp_test/in/transliterate_vals.in -k SEQ -s A -r n -O $BP_TMP/transliterate_vals.out ... OK
Testing transliterate_vals -I $BP_DIR/bp_test/in/transliterate_vals.in -k SEQ_NAME -d Tt -O $BP_TMP/transliterate_vals.out ... OK
Testing uniq_seq -I $BP_DIR/bp_test/in/uniq_seq.in -O $BP_TMP/uniq_seq.out ... OK
Testing uniq_seq -I $BP_DIR/bp_test/in/uniq_seq.in -c -O $BP_TMP/uniq_seq.out ... OK
Testing uniq_vals -I $BP_DIR/bp_test/in/uniq_vals.in -k SEQ -O $BP_TMP/uniq_vals.out ... OK
Testing uniq_vals -I $BP_DIR/bp_test/in/uniq_vals.in -k SEQ -i -O $BP_TMP/uniq_vals.out ... OK
Testing uppercase_seq -I $BP_DIR/bp_test/in/uppercase_seq.in -O $BP_TMP/uppercase_seq.out ... OK
Testing write_blast -I $BP_DIR/bp_test/in/write_blast.in -o $BP_TMP/write_blast.out -x ... OK
Testing write_blast -I $BP_DIR/bp_test/in/write_blast.in -c -o $BP_TMP/write_blast.out -x ... OK
Testing write_blast -I $BP_DIR/bp_test/in/write_blast.in -Z -o $BP_TMP/write_blast.out.gz -x ... OK
Testing write_fasta -I $BP_DIR/bp_test/in/write_fasta.in -o $BP_TMP/write_fasta.out -x ... OK
Testing write_fasta -I $BP_DIR/bp_test/in/write_fasta.in -w 4 -o $BP_TMP/write_fasta.out -x ... OK
Testing write_fasta -I $BP_DIR/bp_test/in/write_fasta.in -w 4 -Z -o $BP_TMP/write_fasta.out.gz -x ... OK
Testing write_fastq -I $BP_DIR/bp_test/in/write_fastq.in -o $BP_TMP/write_fastq.out -x ... OK
Testing write_fastq -I $BP_DIR/bp_test/in/write_fastq.in -Z -o $BP_TMP/write_fastq.out.gz -x ... OK
Testing write_tab -I $BP_DIR/bp_test/in/write_tab.in -o $BP_TMP/write_tab.out -x ... OK
Testing write_tab -I $BP_DIR/bp_test/in/write_tab.in -c -o $BP_TMP/write_tab.out -x ... OK
Testing write_tab -I $BP_DIR/bp_test/in/write_tab.in -d ',' -o $BP_TMP/write_tab.out -x ... OK
Testing write_tab -I $BP_DIR/bp_test/in/write_tab.in -Z -o $BP_TMP/write_tab.out.gz -x ... OK
Testing write_tab -I $BP_DIR/bp_test/in/write_tab.in -k 'Count' -o $BP_TMP/write_tab.out -x ... OK
Testing write_tab -I $BP_DIR/bp_test/in/write_tab.in -K 'Count' -o $BP_TMP/write_tab.out -x ... OK
Biopieces tested: 63 Tests run: 182 OK: 151 FAIL: 19 WARNING: 12 Time: 32 secs

[fabrice]

For analyze_gc, Biopiece do like this:
gc%=(g+c)/(a+c+g+t+N)

Can we do like this:
gc%=(g+c)/(a+c+g+t)
Not count N.