Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • induivain
    Junior Member
    • Sep 2011
    • 9

    Problem with Haloplex variant call

    Hi seqanwers

    I am working on Haloplex data
    I doing comparisons between the same sample, with two different technologies, haloplex and Sureselect, I have found the following thing In the call variants step (picture)

    A great number of discrepancies are found in the last nucleotide of a lot of reads n haloplex data

    I check by sanger some of these positions , and the was negative.

    That I am doing badly?

    I hope that you could help me or someone of agilent.

    In my bioinformatic pipeline , first I remove the haloplex adaptors on the two sides.
    >PrefixPE/1
    AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
    >PrefixPE/2
    AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT

    with cutadapt and run in BWA-mem , and GATK best practices (don't remove duplicates)

    all opinions are welcome.

    Induivain
    Attached Files
    Last edited by induivain; 02-14-2014, 08:46 AM.

Latest Articles

Collapse

  • SEQadmin2
    Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by SEQadmin2


    I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

    Here are nine questions we think about, in roughly the order they matter, before...
    06-18-2026, 07:11 AM
  • SEQadmin2
    From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
    by SEQadmin2


    Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


    The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
    ...
    06-02-2026, 10:05 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 06-17-2026, 06:09 AM
0 responses
38 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-09-2026, 11:58 AM
0 responses
101 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-05-2026, 10:09 AM
0 responses
123 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-04-2026, 08:59 AM
0 responses
114 views
0 reactions
Last Post SEQadmin2  
Working...