Any chance you can tell us the version you are using?
Also, is there any parameter to make the bam store the original CS calls?
Seqanswers Leaderboard Ad
Collapse
Announcement
Collapse
No announcement yet.
X
-
I am using the version that dumps .bam. Then I post-process to .sam and cleaned it up for cufflinks.
Here's a few entries with really low scores.
Code:1847_606_2027 256 Contig78899 2917 0 31M19H * 0 0 TGAATGACCTTGACCTACTTTTCAATGACCT DIFE>DIII'&->E4AIHFH;.:IIFAFID2 XS:A:+ 763_1093_180 256 Contig78899 2917 1 34M16H * 0 0 TGAATGACCTTGACCTACTTTTCAATGACCTTGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII:H XS:A:+ 955_1354_927 256 Contig78899 2917 1 27M23H * 0 0 TGAATGACCTTGACCTACTTTTCAATG 77CIEEIIIIHFDIIIHGIIIDIIIA1 XS:A:+ 1347_1328_414 256 Contig78899 2919 0 15H31M4H * 0 0 AATGACCTTGACCTACTTTTCAATGACCTTG EAIIIIE<0:%%II>FIIIIIIIIIIIIDII XS:A:+ 1062_1345_1564 272 Contig78899 2919 0 21H29M * 0 0 AATGACCTTGACCTACTTTTCAATGACCT I6EIII&&IIIGIIIII=>I>%%:IIICI XS:A:- 1648_875_1465 272 Contig78899 2921 0 22H28M * 0 0 TGACCTTGACCTACTTTTCAATGACCTT "7G7*-;FE<1AI=4##IIIIIIIIIII XS:A:- 1314_701_16 272 Contig78899 2922 0 23H27M * 0 0 GACCTTGACCTACTTTTCAATGACCTT %+1,-6C%%.*5##7:IIIIIIIIIII XS:A:- 1551_763_1651 272 Contig78899 2922 0 23H27M * 0 0 GACCTTGACCTACTTTTCAATGACCTT "I=,2CIF>$$;>70DIIIIIIIIIII XS:A:- 1238_1512_669 272 Contig78899 2940 0 24H26M * 0 0 AATGACCTTGAAAAATTATGATGAGT IGIIIIIIIIIII==I><IIIIIIII XS:A:-
Leave a comment:
-
Originally posted by damiankao View PostDoes anyone know if Bioscope sam output's mapping quality score follows sam specifications? I noticed I have a lot of 0's in the 4th mapping quality column in my Bioscope output alignments. I also see some 100's. I thought mapping quality is 0-99?
Can you dump some entries from your BAM?
Leave a comment:
-
Originally posted by damiankao View PostDoes anyone know if Bioscope sam output's mapping quality score follows sam specifications? I noticed I have a lot of 0's in the 4th mapping quality column in my Bioscope output alignments. I also see some 100's. I thought mapping quality is 0-99?
Leave a comment:
-
Bioscope sam output
Does anyone know if Bioscope sam output's mapping quality score follows sam specifications? I noticed I have a lot of 0's in the 4th mapping quality column in my Bioscope output alignments. I also see some 100's. I thought mapping quality is 0-99?Last edited by damiankao; 03-22-2010, 07:17 AM.Tags: None
Latest Articles
Collapse
-
by seqadmin
The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...-
Channel: Articles
04-22-2024, 07:01 AM -
-
by seqadmin
Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...-
Channel: Articles
04-04-2024, 04:25 PM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, Yesterday, 11:49 AM
|
0 responses
15 views
0 likes
|
Last Post
by seqadmin
Yesterday, 11:49 AM
|
||
Started by seqadmin, 04-24-2024, 08:47 AM
|
0 responses
16 views
0 likes
|
Last Post
by seqadmin
04-24-2024, 08:47 AM
|
||
Started by seqadmin, 04-11-2024, 12:08 PM
|
0 responses
61 views
0 likes
|
Last Post
by seqadmin
04-11-2024, 12:08 PM
|
||
Started by seqadmin, 04-10-2024, 10:19 PM
|
0 responses
60 views
0 likes
|
Last Post
by seqadmin
04-10-2024, 10:19 PM
|
Leave a comment: