Tweet
I'd appreciate if anybody could let me know any easy ways to convert capital to small letters of exon sequences in a sam/bam files or point to any relevant threads.
Thanks in advance.
Aki
Thanks in advance.
Aki
-
-
even if you could do this, I'm afraid tools like samtools would convert the bases to uppercase.
here is a test with samtools 1.18, everything is converted to uppercase.
Code:@SQ SN:ref LN:45 @SQ SN:ref2 LN:40 r001 163 ref 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 r002 0 ref 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * r003 0 ref 9 30 5H6M * 0 0 AGCTAA * r004 0 ref 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * r003 16 ref 29 30 6H5M * 0 0 TAGGC * r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT * x1 0 ref2 1 30 20M * 0 0 aggttttataaaacaaataa ???????????????????? x2 0 ref2 2 30 21M * 0 0 ggttttataaaacaaataatt ????????????????????? x3 0 ref2 6 30 9M4I13M * 0 0 ttataaaacAAATaattaagtctaca ?????????????????????????? x4 0 ref2 10 30 25M * 0 0 CaaaTaattaagtctacagagcaac ????????????????????????? x5 0 ref2 12 30 24M * 0 0 aaTaattaagtctacagagcaact ???????????????????????? x6 0 ref2 14 30 23M * 0 0 Taattaagtctacagagcaacta ???????????????????????
and now piped into a simple samtools view:
Code:~$ ~/samtools-0.1.18/samtools view -S ~/samtools-0.1.18/examples/toy.sam [samopen] SAM header is present: 2 sequences. r001 163 ref 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 r002 0 ref 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * r003 0 ref 9 30 5H6M * 0 0 AGCTAA * r004 0 ref 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * r003 16 ref 29 30 6H5M * 0 0 TAGGC * r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT * x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA ???????????????????? x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ???????????????????????
-
BAM files have no concept of case, they simply encode the base call as a 4 bit integer. While you could do this in a SAM file, it might break a lot of down-stream applications.Comment
-
The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...04-22-2024, 07:01 AM -
Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...04-04-2024, 04:25 PM
Comment