Converting capital to small letter of Exon sequences in SAM/BAM

[akh22]

I'd appreciate if anybody could let me know any easy ways to convert capital to small letters of exon sequences in a sam/bam files or point to any relevant threads.

Thanks in advance.

Aki

[lindenb]

even if you could do this, I'm afraid tools like samtools would convert the bases to uppercase.
here is a test with samtools 1.18, everything is converted to uppercase.

@SQ	SN:ref	LN:45
@SQ	SN:ref2	LN:40
r001	163	ref	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112
r002	0	ref	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*
r003	0	ref	9	30	5H6M	*	0	0	AGCTAA	*
r004	0	ref	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*
r003	16	ref	29	30	6H5M	*	0	0	TAGGC	*
r001	83	ref	37	30	9M	=	7	-39	CAGCGCCAT	*
x1	0	ref2	1	30	20M	*	0	0	aggttttataaaacaaataa	????????????????????
x2	0	ref2	2	30	21M	*	0	0	ggttttataaaacaaataatt	?????????????????????
x3	0	ref2	6	30	9M4I13M	*	0	0	ttataaaacAAATaattaagtctaca	??????????????????????????
x4	0	ref2	10	30	25M	*	0	0	CaaaTaattaagtctacagagcaac	?????????????????????????
x5	0	ref2	12	30	24M	*	0	0	aaTaattaagtctacagagcaact	????????????????????????
x6	0	ref2	14	30	23M	*	0	0	Taattaagtctacagagcaacta	???????????????????????

and now piped into a simple samtools view:

~$ ~/samtools-0.1.18/samtools view -S ~/samtools-0.1.18/examples/toy.sam
[samopen] SAM header is present: 2 sequences.
r001	163	ref	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112
r002	0	ref	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*
r003	0	ref	9	30	5H6M	*	0	0	AGCTAA	*
r004	0	ref	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*
r003	16	ref	29	30	6H5M	*	0	0	TAGGC	*
r001	83	ref	37	30	9M	=	7	-39	CAGCGCCAT	*
x1	0	ref2	1	30	20M	*	0	0	AGGTTTTATAAAACAAATAA	????????????????????
x2	0	ref2	2	30	21M	*	0	0	GGTTTTATAAAACAAATAATT	?????????????????????
x3	0	ref2	6	30	9M4I13M	*	0	0	TTATAAAACAAATAATTAAGTCTACA	??????????????????????????
x4	0	ref2	10	30	25M	*	0	0	CAAATAATTAAGTCTACAGAGCAAC	?????????????????????????
x5	0	ref2	12	30	24M	*	0	0	AATAATTAAGTCTACAGAGCAACT	????????????????????????
x6	0	ref2	14	30	23M	*	0	0	TAATTAAGTCTACAGAGCAACTA	???????????????????????

[dpryan]

BAM files have no concept of case, they simply encode the base call as a 4 bit integer. While you could do this in a SAM file, it might break a lot of down-stream applications.