Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Converting capital to small letter of Exon sequences in SAM/BAM

    I'd appreciate if anybody could let me know any easy ways to convert capital to small letters of exon sequences in a sam/bam files or point to any relevant threads.

    Thanks in advance.

    Aki

  • #2
    even if you could do this, I'm afraid tools like samtools would convert the bases to uppercase.
    here is a test with samtools 1.18, everything is converted to uppercase.

    Code:
    @SQ	SN:ref	LN:45
    @SQ	SN:ref2	LN:40
    r001	163	ref	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112
    r002	0	ref	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*
    r003	0	ref	9	30	5H6M	*	0	0	AGCTAA	*
    r004	0	ref	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*
    r003	16	ref	29	30	6H5M	*	0	0	TAGGC	*
    r001	83	ref	37	30	9M	=	7	-39	CAGCGCCAT	*
    x1	0	ref2	1	30	20M	*	0	0	aggttttataaaacaaataa	????????????????????
    x2	0	ref2	2	30	21M	*	0	0	ggttttataaaacaaataatt	?????????????????????
    x3	0	ref2	6	30	9M4I13M	*	0	0	ttataaaacAAATaattaagtctaca	??????????????????????????
    x4	0	ref2	10	30	25M	*	0	0	CaaaTaattaagtctacagagcaac	?????????????????????????
    x5	0	ref2	12	30	24M	*	0	0	aaTaattaagtctacagagcaact	????????????????????????
    x6	0	ref2	14	30	23M	*	0	0	Taattaagtctacagagcaacta	???????????????????????

    and now piped into a simple samtools view:
    Code:
    ~$ ~/samtools-0.1.18/samtools view -S ~/samtools-0.1.18/examples/toy.sam
    [samopen] SAM header is present: 2 sequences.
    r001	163	ref	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112
    r002	0	ref	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*
    r003	0	ref	9	30	5H6M	*	0	0	AGCTAA	*
    r004	0	ref	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*
    r003	16	ref	29	30	6H5M	*	0	0	TAGGC	*
    r001	83	ref	37	30	9M	=	7	-39	CAGCGCCAT	*
    x1	0	ref2	1	30	20M	*	0	0	AGGTTTTATAAAACAAATAA	????????????????????
    x2	0	ref2	2	30	21M	*	0	0	GGTTTTATAAAACAAATAATT	?????????????????????
    x3	0	ref2	6	30	9M4I13M	*	0	0	TTATAAAACAAATAATTAAGTCTACA	??????????????????????????
    x4	0	ref2	10	30	25M	*	0	0	CAAATAATTAAGTCTACAGAGCAAC	?????????????????????????
    x5	0	ref2	12	30	24M	*	0	0	AATAATTAAGTCTACAGAGCAACT	????????????????????????
    x6	0	ref2	14	30	23M	*	0	0	TAATTAAGTCTACAGAGCAACTA	???????????????????????

    Comment


    • #3
      BAM files have no concept of case, they simply encode the base call as a 4 bit integer. While you could do this in a SAM file, it might break a lot of down-stream applications.

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Current Approaches to Protein Sequencing
        by seqadmin


        Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
        04-04-2024, 04:25 PM
      • seqadmin
        Strategies for Sequencing Challenging Samples
        by seqadmin


        Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
        03-22-2024, 06:39 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, 04-11-2024, 12:08 PM
      0 responses
      13 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-10-2024, 10:19 PM
      0 responses
      17 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-10-2024, 09:21 AM
      0 responses
      14 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-04-2024, 09:00 AM
      0 responses
      43 views
      0 likes
      Last Post seqadmin  
      Working...
      X