Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • vishwesh
    Member
    • Nov 2013
    • 39

    Cutadapt - help.

    Hi,
    I am using cutadapt for removing the adapter sequence. I have 2 adapter sequence.

    RNA 5Adapter (RA5)
    5 GUUCAGAGUUCUACAGUCCGACGAUC
    RNA 3?Adapter (RA3)
    5 TGGAATTCTCGGGTGCCAAGG

    The 1st one is 5' adapter and 2nd is 3' adapter.

    I am using the following command line to remove the adapter seq.

    cutadapt -a TGGAATTCTCGGGTGCCAAGG -g GUUCAGAGUUCUACAGUCCGACGAUC input.fastq > output.fastq

    Length Distribution I get
    Mean sequence length: 32.49 ± 10.53 bp
    Minimum length: 16 bp
    Maximum length: 51 bp
    Length range: 36 bp
    Mode length: 51 bp with 2,852,626 sequences


    And I found that the 5' adapter has U instead of T. Will that be fine?

    I tried replacing U with T GUUCAGAGUUCUACAGUCCGACGAUC > GTTCAGAGTTCTACAGTCCGACGATC and tried removing adapter sequence.

    cutadapt -a TGGAATTCTCGGGTGCCAAGG -g GTTCAGAGTTCTACAGTCCGACGATC input.fastq > output.fastq

    Length Distribution I get
    Mean sequence length: 31.26 ± 11.29 bp
    Minimum length: 1 bp
    Maximum length: 51 bp
    Length range: 51 bp
    Mode length: 51 bp with 2,805,271 sequences

    I get varied length distribution in both the cases. Which one should I choose..
    First is the command that I am using is right??
    I am working on small RNA seq data.
    Kindly let me know.

    Thanks in advance.

    Regards
    Vishwesh
  • Brian Bushnell
    Super Moderator
    • Jan 2014
    • 2709

    #2
    Reads don't come out of sequencers with 'U' in them, just 'T', so don't use 'U' for postprocessing reads. Some tools may understand it but most won't.

    And a varied length distribution is expected, is it not?

    Comment

    • vishwesh
      Member
      • Nov 2013
      • 39

      #3
      Thanks for the response.
      Hope the command that I use is correct.
      Can you pls let me know how remove 5' adapter and 3' adapter using cutadapt??

      Regards
      Vishwesh

      Comment

      • Brian Bushnell
        Super Moderator
        • Jan 2014
        • 2709

        #4
        Well, no, I don't use cutadapt. I can advise you on bbduk, though.

        bbduk.sh -Xmx1g in=input.fq out=trimmed3.fq ktrim=r literal=TGGAATTCTCGGGTGCCAAGG k=19 mink=12

        This will trim to the right when finding an adapter.

        bbduk.sh -Xmx1g in=trimmed3.fq out=trimmed3_5.fq ktrim=l literal=GTTCAGAGTTCTACAGTCCGACGATC k=19 mink=12

        This will trim to the left when finding an adapter.

        If you want to allow a mismatch, you can set "hdist=1".

        -Brian

        Comment

        • relipmoc
          Member
          • Jul 2011
          • 58

          #5
          try skewer

          skewer is also qualified for trimming adapters from small-RNA reads.

          for your case, you may use the following command:

          Code:
          skewer -x TGGAATTCTCGGGTGCCAAGG small-RNA.fastq -1 | skewer -x GUUCAGAGUUCUACAGUCCGACGAUC -m head -r 0 -l 21 -L 25 -o trimmed -

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
            by SEQadmin2


            Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


            The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
            ...
            Yesterday, 10:05 AM
          • SEQadmin2
            Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends
            by SEQadmin2


            With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.


            Introduction

            Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
            05-22-2026, 06:42 AM
          • SEQadmin2
            Environmental Genomics in the Age of NGS: From Microbes to Conservation Strategies
            by SEQadmin2

            Studying ecosystems means dealing with complex, multi-species communities that are hard to observe at scale. This complexity, however, hides many important questions to be answered, from how biogeochemical cycles work and how climate change can affect species distribution to how conservation strategies can work best.


            Genomics, particularly since the expansion of NGS, has transformed ecosystem ecology. By sequencing environmental DNA, we can now assess biodiversity without direct...
            05-06-2026, 09:04 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, Yesterday, 12:03 PM
          0 responses
          19 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, Yesterday, 11:40 AM
          0 responses
          14 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 05-28-2026, 11:40 AM
          0 responses
          29 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 05-26-2026, 10:12 AM
          0 responses
          31 views
          0 reactions
          Last Post SEQadmin2  
          Working...