Seqanswers Leaderboard Ad



No announcement yet.
  • Filter
  • Time
  • Show
Clear All
new posts

  • PE data processed by bwa

    I am processing the PE solexa data using BWA, I met a problem after I looked through the sampe result.

    Although I set the -a(maximum insert size) to be 300, I still found lots of PE mapped with the insertion > 300bp, some even around 5000bp. When I do the pileup, if these PE reads would be taken into consideration ?
    or I should remove these reads manually?

    At the same time, there are also some reads mapped without mate, they are still in the sampe file, will they be taken into account when I do the pileup ?

    All in all, will all the mapped reads(even not in pair or have anomalous insertion distance) in the sampe will be used in the pileup?

  • #2
    You should check FLAG 0x2 (see sam spec), not just looking at ISIZE. Anomalous pairs will used by pileup by default. But you can throw them away by:

    samtools view -uf2 aln.bam|samtools pileup -


    • #3
      Thanks, lh3.

      if I want to use -F to filter out two Flags, or -f to keep two Flags, should I use -F 48, otherwise, I can run -F 4, and -F 8 separately.

      I met the flag 87 with my pair-end data like I show below. I think it maybe due to two possibilities:
      1, software bug.
      2, The match was detected by Smith-Waterman for the unmapped mate.

      No matter which is true, it would cause some problem with other softwares,for example, when i use Tablet to visualize the mapping, the flag will crash the loading.

      SOLEXA-GA05_PEi_JG_SP_KG_DQ_QF:5:79:9492:4342#GCTCCAA 87 human_L19 4890 60 76M = 4765 -201 GCCTCCCACCCAAAATGAGTTCCTGCTCTTCCTCCTTGCCCCTCAGCCCTAGTCATTTCCTCATTTGCAGTTCCCC /14414:4494738:<6968>9?<8=;A=>:?>??:=9;96==?;;:<>>=<=<<<>;:A;=>;:=9<98976363 XT:A:U NM:i:2 SM:i:37 AM:i:23 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:10A64T0
      SOLEXA-GA05_PEi_JG_SP_KG_DQ_QF:5:79:9492:4342#GCTCCAA 163 human_L19 4765 60 76M = 4890 201 CTGTATTTGCATTTGCTGTCTTGCTGGTCTCAAGATTCCCAAGCGCTGCTGCCAGCCCACCCCTTCAGCCTGCCAA 3186><:;::=:9@?;:<9;:7:96<;=<9>A<;><8:=7;;><:99977:66<95:58847421110/202/02- XT:A:U NM:i:0 SM:i:23 AM:i:23 X0:i:1 X1:i:2 XM:i:0 XO:i:0 XG:i:0 MD:Z:76 XA:Z:human_L19,+4765,75M1S,4;human_L19,+4765,76M,5;


      Latest Articles


      • seqadmin
        Recent Advances in Sequencing Analysis Tools
        by seqadmin

        The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
        05-06-2024, 07:48 AM
      • seqadmin
        Essential Discoveries and Tools in Epitranscriptomics
        by seqadmin

        The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
        04-22-2024, 07:01 AM





      Topics Statistics Last Post
      Started by seqadmin, 05-14-2024, 07:03 AM
      0 responses
      Last Post seqadmin  
      Started by seqadmin, 05-10-2024, 06:35 AM
      0 responses
      Last Post seqadmin  
      Started by seqadmin, 05-09-2024, 02:46 PM
      0 responses
      Last Post seqadmin  
      Started by seqadmin, 05-07-2024, 06:57 AM
      0 responses
      Last Post seqadmin  