Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • PE data processed by bwa

    I am processing the PE solexa data using BWA, I met a problem after I looked through the sampe result.

    Although I set the -a(maximum insert size) to be 300, I still found lots of PE mapped with the insertion > 300bp, some even around 5000bp. When I do the pileup, if these PE reads would be taken into consideration ?
    or I should remove these reads manually?

    At the same time, there are also some reads mapped without mate, they are still in the sampe file, will they be taken into account when I do the pileup ?

    All in all, will all the mapped reads(even not in pair or have anomalous insertion distance) in the sampe will be used in the pileup?

  • #2
    You should check FLAG 0x2 (see sam spec), not just looking at ISIZE. Anomalous pairs will used by pileup by default. But you can throw them away by:

    samtools view -uf2 aln.bam|samtools pileup -

    Comment


    • #3
      Thanks, lh3.

      if I want to use -F to filter out two Flags, or -f to keep two Flags, should I use -F 48, otherwise, I can run -F 4, and -F 8 separately.

      I met the flag 87 with my pair-end data like I show below. I think it maybe due to two possibilities:
      1, software bug.
      2, The match was detected by Smith-Waterman for the unmapped mate.

      No matter which is true, it would cause some problem with other softwares,for example, when i use Tablet to visualize the mapping, the flag will crash the loading.

      SOLEXA-GA05_PEi_JG_SP_KG_DQ_QF:5:79:9492:4342#GCTCCAA 87 human_L19 4890 60 76M = 4765 -201 GCCTCCCACCCAAAATGAGTTCCTGCTCTTCCTCCTTGCCCCTCAGCCCTAGTCATTTCCTCATTTGCAGTTCCCC /14414:4494738:<6968>9?<8=;A=>:?>??:=9;96==?;;:<>>=<=<<<>;:A;=>;:=9<98976363 XT:A:U NM:i:2 SM:i:37 AM:i:23 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:10A64T0
      SOLEXA-GA05_PEi_JG_SP_KG_DQ_QF:5:79:9492:4342#GCTCCAA 163 human_L19 4765 60 76M = 4890 201 CTGTATTTGCATTTGCTGTCTTGCTGGTCTCAAGATTCCCAAGCGCTGCTGCCAGCCCACCCCTTCAGCCTGCCAA 3186><:;::=:9@?;:<9;:7:96<;=<9>A<;><8:=7;;><:99977:66<95:58847421110/202/02- XT:A:U NM:i:0 SM:i:23 AM:i:23 X0:i:1 X1:i:2 XM:i:0 XO:i:0 XG:i:0 MD:Z:76 XA:Z:human_L19,+4765,75M1S,4;human_L19,+4765,76M,5;

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Non-Coding RNA Research and Technologies
        by seqadmin


        Non-coding RNAs (ncRNAs) do not code for proteins but play important roles in numerous cellular processes including gene silencing, developmental pathways, and more. There are numerous types including microRNA (miRNA), long ncRNA (lncRNA), circular RNA (circRNA), and more. In this article, we discuss innovative ncRNA research and explore recent technological advancements that improve the study of ncRNAs.

        [Article Coming Soon!]...
        Today, 08:07 AM
      • seqadmin
        Recent Developments in Metagenomics
        by seqadmin





        Metagenomics has improved the way researchers study microorganisms across diverse environments. Historically, studying microorganisms relied on culturing them in the lab, a method that limits the investigation of many species since most are unculturable1. Metagenomics overcomes these issues by allowing the study of microorganisms regardless of their ability to be cultured or the environments they inhabit. Over time, the field has evolved, especially with the advent...
        09-23-2024, 06:35 AM
      • seqadmin
        Understanding Genetic Influence on Infectious Disease
        by seqadmin




        During the COVID-19 pandemic, scientists observed that while some individuals experienced severe illness when infected with SARS-CoV-2, others were barely affected. These disparities left researchers and clinicians wondering what causes the wide variations in response to viral infections and what role genetics plays.

        Jean-Laurent Casanova, M.D., Ph.D., Professor at Rockefeller University, is a leading expert in this crossover between genetics and infectious...
        09-09-2024, 10:59 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, 10-02-2024, 04:51 AM
      0 responses
      13 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 10-01-2024, 07:10 AM
      0 responses
      23 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 09-30-2024, 08:33 AM
      1 response
      29 views
      0 likes
      Last Post EmiTom
      by EmiTom
       
      Started by seqadmin, 09-26-2024, 12:57 PM
      0 responses
      19 views
      0 likes
      Last Post seqadmin  
      Working...
      X