Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • mingkunli
    Member
    • Jan 2009
    • 42

    PE data processed by bwa

    I am processing the PE solexa data using BWA, I met a problem after I looked through the sampe result.

    Although I set the -a(maximum insert size) to be 300, I still found lots of PE mapped with the insertion > 300bp, some even around 5000bp. When I do the pileup, if these PE reads would be taken into consideration ?
    or I should remove these reads manually?

    At the same time, there are also some reads mapped without mate, they are still in the sampe file, will they be taken into account when I do the pileup ?

    All in all, will all the mapped reads(even not in pair or have anomalous insertion distance) in the sampe will be used in the pileup?
  • lh3
    Senior Member
    • Feb 2008
    • 686

    #2
    You should check FLAG 0x2 (see sam spec), not just looking at ISIZE. Anomalous pairs will used by pileup by default. But you can throw them away by:

    samtools view -uf2 aln.bam|samtools pileup -

    Comment

    • mingkunli
      Member
      • Jan 2009
      • 42

      #3
      Thanks, lh3.

      if I want to use -F to filter out two Flags, or -f to keep two Flags, should I use -F 48, otherwise, I can run -F 4, and -F 8 separately.

      I met the flag 87 with my pair-end data like I show below. I think it maybe due to two possibilities:
      1, software bug.
      2, The match was detected by Smith-Waterman for the unmapped mate.

      No matter which is true, it would cause some problem with other softwares,for example, when i use Tablet to visualize the mapping, the flag will crash the loading.

      SOLEXA-GA05_PEi_JG_SP_KG_DQ_QF:5:79:9492:4342#GCTCCAA 87 human_L19 4890 60 76M = 4765 -201 GCCTCCCACCCAAAATGAGTTCCTGCTCTTCCTCCTTGCCCCTCAGCCCTAGTCATTTCCTCATTTGCAGTTCCCC /14414:4494738:<6968>9?<8=;A=>:?>??:=9;96==?;;:<>>=<=<<<>;:A;=>;:=9<98976363 XT:A:U NM:i:2 SM:i:37 AM:i:23 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:10A64T0
      SOLEXA-GA05_PEi_JG_SP_KG_DQ_QF:5:79:9492:4342#GCTCCAA 163 human_L19 4765 60 76M = 4890 201 CTGTATTTGCATTTGCTGTCTTGCTGGTCTCAAGATTCCCAAGCGCTGCTGCCAGCCCACCCCTTCAGCCTGCCAA 3186><:;::=:9@?;:<9;:7:96<;=<9>A<;><8:=7;;><:99977:66<95:58847421110/202/02- XT:A:U NM:i:0 SM:i:23 AM:i:23 X0:i:1 X1:i:2 XM:i:0 XO:i:0 XG:i:0 MD:Z:76 XA:Z:human_L19,+4765,75M1S,4;human_L19,+4765,76M,5;

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM
      • SEQadmin2
        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
        by SEQadmin2



        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
        07-08-2026, 05:17 AM
      • GATTACAT
        Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
        by GATTACAT
        Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
        07-01-2026, 11:43 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, 07-13-2026, 10:26 AM
      0 responses
      18 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-09-2026, 10:04 AM
      0 responses
      30 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-08-2026, 10:08 AM
      0 responses
      16 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-07-2026, 11:05 AM
      0 responses
      34 views
      0 reactions
      Last Post SEQadmin2  
      Working...