Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • sekta
    Junior Member
    • Dec 2013
    • 5

    bowtie - multiple mapped sequences

    Dear Bowtie Users,

    I noticed that in my mapping results some uniquely mapped sequences are reported to be mapped multiple times. How come?



    I am mapping to miRbase data base. I prepared indexes twice as I did mapping. Each time the same result.

    Ps. Mapping options:
    sudo ./bowtie -p 1 -f -v 0 -l 15 -a indexes/miRbase samples/CPM15_SignReads.fa map_m_v0.map

    Could you please help me and solve the mystery?
  • dpryan
    Devon Ryan
    • Jul 2011
    • 3478

    #2
    Try using the SAM output format, nothing reads the bowtie format anymore and it lacks too much information to make much sense out of anything.

    Comment

    • sekta
      Junior Member
      • Dec 2013
      • 5

      #3
      Dear Dpryan,

      thank you for you advice, here I put the same bowtie output, but in SAM format

      ania@ania:~/Programy/bowtie-1.0.0$ cat map_m_v0.sam | grep TGTAAACATCCTTGACTGGAAGCT
      3356 0 hsa-mir-30e 17 255 24M * 0 0 TGTAAACATCCTTGACTGGAAGCT IIIIIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:24 NM:i:0
      3534 4 * 0 0 * * 0 0 TGTAAACATCCTTGACTGGAAGCTT IIIIIIIIIIIIIIIIIIIIIIIII XM:i:0
      ania@ania:~/Programy/bowtie-1.0.0$

      Comment

      • ecSeq Bioinformatics
        Senior Member
        • May 2012
        • 492

        #4
        These are two different sequences! Let me write it different, that you can see the difference:
        TGTAAACATCCTTGACTGGAAGCT <- your grep call
        TGTAAACATCCTTGACTGGAAGCT <- hit 1 (found in your db)
        TGTAAACATCCTTGACTGGAAGCTT <- hit 2 (not mapped to your db)
        ecSeq Bioinformatics is Europe’s leading provider of hands-on bioinformatics workshops and professional data analysis in the field of Next-Generation Sequencing (NGS).

        Comment

        • sekta
          Junior Member
          • Dec 2013
          • 5

          #5
          Yes, so why im my results in .map format there is one more alignment for TGTAAACATCCTTGACTGGAAGCT reported?

          ** 1 at the end of the line in .map format means "one more", there should be 0 as the alignment is unique

          Comment

          • dpryan
            Devon Ryan
            • Jul 2011
            • 3478

            #6
            I wouldn't be surprised if the function that outputs the default bowtie format has a bug, since no one uses it anymore.

            Comment

            • sekta
              Junior Member
              • Dec 2013
              • 5

              #7
              Thanks Dpryan, probably you are right.

              Comment

              Latest Articles

              Collapse

              • mylaser
                Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                by mylaser
                Kheloyar – Everything You Need to Know About Kheloyaar Login and Kheoyar Id
                If you are looking for an online gaming platform that offers a user-friendly experience, Kheloyar has become a name that many users search for. Whether you're interested in creating a new account, accessing your dashboard through Kheloyaar Login, or learning how to obtain a Kheoyar Id, understanding the platform's features and account process is essential.
                This guide explains everything you need to know about...
                Today, 01:13 AM
              • SEQadmin2
                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                by SEQadmin2



                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                ...
                07-09-2026, 11:10 AM
              • SEQadmin2
                Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                by SEQadmin2



                Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                07-08-2026, 05:17 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, 07-09-2026, 10:04 AM
              0 responses
              17 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-08-2026, 10:08 AM
              0 responses
              10 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-07-2026, 11:05 AM
              0 responses
              22 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-02-2026, 11:08 AM
              0 responses
              31 views
              0 reactions
              Last Post SEQadmin2  
              Working...