Announcement

Collapse
No announcement yet.

what is a paired-end read?

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • #76
    Code:
    for example we have two fragments.
    S1: ATCGTTGAGCAGACT and S2: TGAGCAGACTTAAGTAGTTTT they have an overlap zone"TGAGCAGACT". so the consensus is:ATCGTTGAGCAGACTTAAGTAGTTTT
    
    we sequenced this two fragments S1 and S2 in paired end reads R1 and R2.
    S1:R1: ATCGTTGAGCA
    S1:R2: AGTCTGCTCAA (illumina read the fragment in the other way so I think that to write in reverse complement. correct me if I'm wrong)
    S2:R1:TGAGCAGACTT
    S2:R2:AAAACTACTTA (reverse complement)I think this way is built the R2.
    
    how to make assembly in this case?
    I speak of here. How the assembly in this case?
    in both files (paired end), is what we must do the merging of the two files?

    Comment


    • #77
      You realize that you are not doing this manually, right? You usually use a program, which creates overlapping/merging reads and gives you the contig.

      Comment


      • #78
        Use Panda or Flash (or probably a number of other programs) to do merging.

        Comment


        • #79
          yes I know.
          I'm talking of phase before getting contigs.
          you know to make an assembly of reads that it must overlap.
          In the case of paired end reads, how to find overlaps between the two files?
          we F1.fq that contains reads RX.1 and F2.fq that contains reads RX.2.
          how to find the overlap between these reads? is what we should do a merging between RX.1 and RX.2?
          So the merging is necessary?
          thanks

          Comment


          • #80
            @Rick/@OTU: In order to avoid a re-hash of things that have been already discussed in other threads I am posting two below.

            http://seqanswers.com/forums/showthread.php?t=63703
            http://seqanswers.com/forums/showthread.php?t=63571

            @mido1951 is either mis-understanding some basic concepts about sequencing/assembly or I am not able to understand what @mid1951 wants to know.

            Comment


            • #81
              Originally posted by mido1951 View Post
              yes I know.
              I'm talking of phase before getting contigs.
              you know to make an assembly of reads that it must overlap.
              In the case of paired end reads, how to find overlaps between the two files?
              we F1.fq that contains reads RX.1 and F2.fq that contains reads RX.2.
              how to find the overlap between these reads? is what we should do a merging between RX.1 and RX.2?
              So the merging is necessary?
              thanks
              It's very simple. You do this:

              bbmerge.sh in1=F1.fq in2=F2.fq out=merged.fq outu=unmerged.fq

              Comment


              • #82
                thanks for your answer.
                So, the merging is necessary ??
                thanks

                Comment


                • #83
                  No, merging is optional.

                  Comment


                  • #84
                    if the merging is optional,
                    how to do overlap reads without merging the two files into one file??

                    Comment

                    Working...
                    X