Announcement

Collapse
No announcement yet.

what is a paired-end read?

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • mido1951
    replied
    if the merging is optional,
    how to do overlap reads without merging the two files into one file??

    Leave a comment:


  • Brian Bushnell
    replied
    No, merging is optional.

    Leave a comment:


  • mido1951
    replied
    thanks for your answer.
    So, the merging is necessary ??
    thanks

    Leave a comment:


  • Brian Bushnell
    replied
    Originally posted by mido1951 View Post
    yes I know.
    I'm talking of phase before getting contigs.
    you know to make an assembly of reads that it must overlap.
    In the case of paired end reads, how to find overlaps between the two files?
    we F1.fq that contains reads RX.1 and F2.fq that contains reads RX.2.
    how to find the overlap between these reads? is what we should do a merging between RX.1 and RX.2?
    So the merging is necessary?
    thanks
    It's very simple. You do this:

    bbmerge.sh in1=F1.fq in2=F2.fq out=merged.fq outu=unmerged.fq

    Leave a comment:


  • GenoMax
    replied
    @Rick/@OTU: In order to avoid a re-hash of things that have been already discussed in other threads I am posting two below.

    http://seqanswers.com/forums/showthread.php?t=63703
    http://seqanswers.com/forums/showthread.php?t=63571

    @mido1951 is either mis-understanding some basic concepts about sequencing/assembly or I am not able to understand what @mid1951 wants to know.

    Leave a comment:


  • mido1951
    replied
    yes I know.
    I'm talking of phase before getting contigs.
    you know to make an assembly of reads that it must overlap.
    In the case of paired end reads, how to find overlaps between the two files?
    we F1.fq that contains reads RX.1 and F2.fq that contains reads RX.2.
    how to find the overlap between these reads? is what we should do a merging between RX.1 and RX.2?
    So the merging is necessary?
    thanks

    Leave a comment:


  • westerman
    replied
    Use Panda or Flash (or probably a number of other programs) to do merging.

    Leave a comment:


  • OTU
    replied
    You realize that you are not doing this manually, right? You usually use a program, which creates overlapping/merging reads and gives you the contig.

    Leave a comment:


  • mido1951
    replied
    Code:
    for example we have two fragments.
    S1: ATCGTTGAGCAGACT and S2: TGAGCAGACTTAAGTAGTTTT they have an overlap zone"TGAGCAGACT". so the consensus is:ATCGTTGAGCAGACTTAAGTAGTTTT
    
    we sequenced this two fragments S1 and S2 in paired end reads R1 and R2.
    S1:R1: ATCGTTGAGCA
    S1:R2: AGTCTGCTCAA (illumina read the fragment in the other way so I think that to write in reverse complement. correct me if I'm wrong)
    S2:R1:TGAGCAGACTT
    S2:R2:AAAACTACTTA (reverse complement)I think this way is built the R2.
    
    how to make assembly in this case?
    I speak of here. How the assembly in this case?
    in both files (paired end), is what we must do the merging of the two files?

    Leave a comment:


  • OTU
    replied
    Sorry, you are right. I meant something different.
    Your previous post depicts the assembly process correctly.
    What I don't understand is what exactly is your question then?

    Leave a comment:


  • mido1951
    replied
    Originally posted by OTU View Post
    R2 reads are not in a form of reverse complement.
    illumina read the fragment from the right.
    so if S1 is read from right, is that we take the reverse complement fragment or fragment from the right?
    In this case R2 is what?

    Leave a comment:


  • OTU
    replied
    R2 reads are not in a form of reverse complement.

    Leave a comment:


  • mido1951
    replied
    for example we have two fragments.
    S1: ATCGTTGAGCAGACT and S2: TGAGCAGACTTAAGTAGTTTT they have an overlap zone"TGAGCAGACT". so the consensus is:ATCGTTGAGCAGACTTAAGTAGTTTT

    we sequenced this two fragments S1 and S2 in paired end reads R1 and R2.
    S1:R1: ATCGTTGAGCA
    S1:R2: AGTCTGCTCAA (illumina read the fragment in the other way so I think that to write in reverse complement. correct me if I'm wrong)
    S2:R1:TGAGCAGACTT
    S2:R2:AAAACTACTTA (reverse complement)I think this way is built the R2.

    how to make assembly in this case?

    Leave a comment:


  • OTU
    replied
    what example are you looking for?

    Leave a comment:


  • mido1951
    replied
    I know the operation of assembly programs.
    but I basically want to understand the overlap between the paired end reads (the two files).
    i have single cell not meta genome.
    have you an example?

    Leave a comment:

Working...
X