[OTU]

Left and right are not complements of each other. They match. That's how they overlap. For denovo assembly try using programs like SOAP denovo
http://soap.genomics.org.cn/soapdenovo.html, or SPADES de novo http://bioinf.spbau.ru/en/. Are your sequences from single cell? Or a metagenome?

[mido1951]

no. i have illumina paired end reads. and I want to denovo assembly without a reference genome.
how the right portion of a reads overlaps with the left portion of another reads? (it was not the same sense od read)
And have you an example

[OTU]

Assembly algorithm will depend whether you have a reference genome or not. Is it a metagenome sequencing?

[mido1951]

how make an assembly with reads (paired end: two files) .
Is it that you can make an example please?
thanks

[OTU]

No. If you have a fragment of DNA: ATCGTTGAGCAGACT,
your R1: TAGCAA
and R2: GTCTGA

[mido1951]

for example:
we have a fragment of DNA: ATCGTTGAGCAGACT
we will sequence this fragment and for example after the paired end sequencing reads we have R1 and R2 with a length 6. Thus:
R1 = ATCGTT
R2 = AGTCTG (reverse complement)
so after sequencing wa have R1..... R2 (the middle part is unknown).
that's the paired end reads.
or not?

[OTU]

Oh, that's just an example of what paired-end pairing looks like.

[mido1951]

how you got these reads !! ??

[OTU]

Then you should consider that overlap is something like:
R1-ATTGCTGTG
-----------ACACTGAAAAGT-R2

[mido1951]

I speak of an example.
it is assumed that it is an overlap.
I want to create an assembly tool but first I need to know how to detect overlap between the paired ends (from two files). and make assembly with paired end.

[OTU]

Don't see why
"F1.fq:
S1: R1=ATCGTTGAG
S2: R1=TGAGCAGAC " would overlap. They only match at 3 bp. Assemblers won't combine them.

[mido1951]

for example:
we have the sequence: S1: ATCGTTGAGCAGACT and the sequence S2: TGAGCAGACTTAAGTAGTTTT .
and for example, was the first sequenced reads from S1: R1 = ATCGTTGAG
R2 = AGTCTGCTC (reverse complement from the right)
and from the second sequence: R1: TGAGCAGAC
R2: AAAACTACT (reverse complement from the right)
So we have the two files paired end:
F1.fq:
S1: R1=ATCGTTGAG
S2: R1=TGAGCAGAC
F2.fq:
S1: R2=AGTCTGCTC
S2: R2=AAAACTACT

in the assembly here there is an overlap between R1(S1) and R1(S2).
in assembly, we can have overlap between R1 and R2 from two differents sequence??

[GenoMax]

I have llumina paired end data.
I want to make an assembly of these data.
But the problem I do not understand the two F1.fq file and F2.fq.
Is that reads and reads of F1.fq F2.fq are complementary or not?
for the assembly do I have to overlap F1.fq or I have to overlap and F1.fq F2.fq?
thanky

Cross-posted: https://www.biostars.org/p/162806/

@mido1951: See this page for a simple explanation of "shotgun sequencing": https://en.wikipedia.org/wiki/Shotgun_sequencing In the past people used sanger sequencing for this, which has now been replaced with NGS.

R1/R2 are merely sequences from the two ends of a fragment. They do not need to be complementary (in fact in most cases they will not be). You do not need to worry about R1/R2 reads individually but use them as a set for assembly.

[mido1951]

I have llumina paired end data.
I want to make an assembly of these data.
But the problem I do not understand the two F1.fq file and F2.fq.
Is that reads and reads of F1.fq F2.fq are complementary or not?
for the assembly do I have to overlap F1.fq or I have to overlap and F1.fq F2.fq?
thanky

[OTU]

What is your data on? Metagenome, single genome?
What sequencing platform did you use? What is the processing computer power that you can use?