samtools view giving error in reading .fa file

[Sharmi]

Hi,

I am new to Bioinformatics and I am trying to use the samtools view command. I have generated the SAM file but the header is missing so I followed this link (http://davetang.org/wiki/tiki-index.php?page=SAMTools) and tried the commands, but I get the following error -

samtools view -bS new_test.sam > new_test.bam
[samopen] no @SQ lines in the header.
[sam_read1] missing header? Abort!
cbil@cbil-desktop:~/bowtie-linux/bowtie-1.0.1$ samtools view -bT e_coli_1000.fa new_test.sam > new_test.bam
[samfaipath] fail to read file e_coli_1000.fa.
[main_samview] fail to open "new_test.sam" for reading.

Can someone please help me?

Thanks!

[blancha]

Converting a FASTA file (sequence file) directly to a BAM (Binary Alignment Map) file makes no sense to me.

You would normally align your sequences in the FASTQ format to a reference genome in the FASTA format, using a program like Bowtie2, to generate a BAM file.

[dpryan]

@blancha: Sharmi isn't trying to convert a fasta file to BAM. His/her problem is that the SAM file lacks a header, which Sharmi is trying to replace with the -T option, though that won't work here since the e_coli_1000.fasta file isn't a reference sequence...

@Sharmi: Don't use the --sam-nohead option with bowtie if that's what you did. The header from the example should be:

@HD     VN:1.0  SO:unsorted
@SQ     SN:gi|110640213|ref|NC_008253.1|        LN:4938920
@PG     ID:Bowtie       VN:1.0.1        CL:"./bowtie -S e_coli reads/e_coli_1000.fq"

You could just add it in manually, since there output file is so small (remember to separate fields with a tab rather than a space).

[blancha]

@dpryan: Yes, you are right. I was trying to be helpful, and answer a question instead of asking one for once, but my answer was wrong .

[dpryan]

@blancha: No worries and don't let that dissuade you from answering posts!

[Sharmi]

Hi,
Thank you for the reply. I am sorry I have a few questions-

I have a e_coli_1000.fa.fai file in the bowtie folder, but if I use -
cbil@cbil-desktop:~/bowtie-linux/bowtie-1.0.1$ samtools view -bt e_coli_1000.fa.fai new_test.sam > new_test.bam
I get the following error -
[main_samview] fail to open "new_test.sam" for reading.
cbil@cbil-desktop:~/bowtie-linux/bowtie-1.0.1$

Is it because of missing headers in the SAM file?

If I compare the SAM file I have with the format mentioned in the link (http://biobits.org/samtools_primer.html), my files start with r0,r1 and the the -/+ for the reverse/forward and then gi... But in the link after the header section there is no r0 or r1. Is there something wrong with my SAM files?

Also should I manually add the first three lines of the header in the SAM file? The current SAM file starts like this (sorry if the questions sound stupid, I am trying to learn the tools for my research) -
r0 - gi|110640213|ref|NC_008253.1| 3658049 ATGCTGGAATGGCGATAGTTGGGTGGGTATCGTTC 45567778999:9;;<===>?@@@@AAAABCCCDE 0 32:T>G,34:G>A
r1 - gi|110640213|ref|NC_008253.1| 1902085 CGGATGATTTTTATCCCATGAGACATCCAGTTCGG 45567778999:9;;<===>?@@@@AAAABCCCDE 0
r2 - gi|110640213|ref|NC_008253.1| 3989609 CATAAAGCAACAGTGTTATACTATAACAATTTTGA 45567778999:9;;<===>?@@@@AAAABCCCDE 0
r5 + gi|110640213|ref|NC_008253.1| 4249841 CAGCATAAGTGGATATTCAAAGTTTTGCTGTTTTA EDCCCBAAAA@@@@?>===<;;9:99987776554 0
r7 + gi|110640213|ref|NC_008253.1| 4086913 GCATATTGCCAATTTTCGCTTCGGGGATCAGGCTA EDCCCBAAAA@@@@?>===<;;9:99987776554 0
r8 + gi|110640213|ref|NC_008253.1| 2679194 GGTTCAGTTCAGTATACGCCTTATCCGGCCTACGG EDCCCBAAAA@@@@?>===<;;9:99987776554 0 14:A>T,33:C>G
r9 - gi|110640213|ref|NC_008253.1| 2430559

Thanks,
Sharmi

[dpryan]

That error might be fixed by using the -S option, but if not it just means that "new_test.sam" doesn't exist in the current working directory.

BTW, the example alignments you posted aren't in SAM format. That's probably the old bowtie format. Never use that.

[Sharmi]

I have installed bowtie 1, do I need to install bowtie 2?

Thanks!