just 2.4% by trimming at 27. i do not know if it's a good average for a 2x300bp, MiSeq 16s and a metaprofilig of another marker
Unconfigured Ad
Collapse
X
-
Is the command you posted, when you got the error the first time copy/paste from your terminal? In that case you simply made the mistake to only load the reverse reads
That may also fit to the error message you got as you would have lost all mates. Interesting, however, that bbduk didn't complain and even produced two fastqs as output?!
Originally posted by cnicolas View Post/data/umb/cichocki/bbmap/bbduk.sh in=/data/umb/cichocki/project2/bbduckdu11avril/project2_R2.fastq in=/data/umb/cichocki/project2/bbduckdu11avril/project2_R2.fastq out1=clean11avril.fastq out2=clean211avril.fastq qtrim=rl trimq=30
Comment
-
Ah! Good eye...Originally posted by WhatsOEver View PostIs the command you posted, when you got the error the first time copy/paste from your terminal? In that case you simply made the mistake to only load the reverse reads
That may also fit to the error message you got as you would have lost all mates. Interesting, however, that bbduk didn't complain and even produced two fastqs as output?!
OK, so here's what's happening:
In1 is set as x.fq. Then, in1 is set as x.fq again (you can do this as many times as you want; BBTools all just overwrite the previous setting with the latest setting). Then, since 2 output files are specified, BBDuk assumes that the input file is interleaved and forces interleaved mode to true. That's a feature, by the way! But, I guess one that could potentially cause problems.Code:in=x.fq in=x.fq
Comment
-
--Hi,
i have a big difference between results using bbduk.sh and trimmomatic trimming single-end reads, i have used the commands below, trimmomatic kept 99.78% survival reads whereas bbduk 91.76%. I don't know which to consider good or not.
Which parameters do you use to use to trim in a good way single-reads ?
thank you --
java -Xmx10g -jar trimmomatic-0.36.jar SE -threads 8 -phred33 D3_464_S2_L001_R1_001.fastq.gz Out_D3_464_S2_L001_R1_001.fastq.gz ILLUMINACLIP:TruSeq3-SE.fa:2:40:15:8:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
TrimmomaticSE: Started with arguments:
-threads 8 -phred33 D3_464_S2_L001_R1_001.fastq.gz Out_D3_464_S2_L001_R1_001.fastq.gz ILLUMINACLIP:/home/jtazi/save/Trimmomatic-0.36/adapters/TruSeq3-SE.fa:
2:40:15:8:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 49512700 Surviving: 49401731 (99.78%) Dropped: 110969 (0.22%)
bbduk.sh Xmx8g in=D3_464_S2_L001_R1_001.fastq.gz out=D3_464_S2_L001_R1_001_trimmed.fastq.gz ref=resources/adapters.fa threads=8 k=13 ktrim=r useshortkmers=t mink=5 qtrim=rl minlength=36 trimq=27
BBDuk version 36.11
Set threads to 8
maskMiddle was disabled because useShortKmers=true
Initial:
Memory: max=8232m, free=7974m, used=258m
Added 2017 kmers; time: 0.570 seconds.
Memory: max=8232m, free=7545m, used=687m
Input is being processed as unpaired
Started output streams: 0.449 seconds.
Processing time: 118.446 seconds.
Input: 49512700 reads 2475635000 bases.
QTrimmed: 7288815 reads (14.72%) 218452414 bases (8.82%)
KTrimmed: 3125475 reads (6.31%) 23413723 bases (0.95%)
Total Removed: 4077445 reads (8.24%) 241866137 bases (9.77%)
Result: 45435255 reads (91.76%) 2233768863 bases (90.23%)
Time: 119.548 seconds.
Reads Processed: 49512k 414.16k reads/sec
Bases Processed: 2475m 20.71m bases/sec
Comment
-
The difference is primarily because you are quality-trimming to Q27, which is too high for almost any purpose. I'd suggest a command more like this:
Code:bbduk.sh -Xmx8g in=D3_464_S2_L001_R1_001.fastq.gz out=D3_464_S2_L001_R1_001_trimmed.fastq.gz ref=resources/adapters.fa threads=8 k=19 mink=5 hdist=1 hdist2=0 ktrim=r qtrim=r minlength=36 trimq=14
Comment
-
BBDuk supports a sliding window; the flags "qtrim=w,4 trimq=15" will give similar behavior to Trimmomatic. But I don't recommend that; the Phred trimming method used by default is optimal, whereas sliding-window trimming is non-optimal.
Comment
-
I am using bbduk.sh to trim fastqs to a given length using the force trim capability. I noticed that the character # is being changed to ! in the Q score line of the trimmed fastq. I was unable to find documentation describing whether this is expected behavior. Would you be able to provide some insight into this? I ran the following command:
../../tools/bbmap/bbduk.sh in=<sample>.fastq.gz out=<trimmed_sample>.fastq.gz ftr=50 ordered=t
Original fastq:
@SN1131:915:HFYN7ADXY:1:1101:21364:2052 1:N:0: CAACCACA
TTTCNCCACCACCACGTCGTTCTTGCGCCTCTTCTTGGCTTTCCGCTTGCGCTTGGGTATCTGGCTTGGGGGGCGGAGTGGATCCTGCTTTCTGGCGGAAA
+
@@@B#2=BFHFHHII<GHIIIHIIIBHIIIIIIIIIIIIGIIIGIIIIIIIHHEEEB;C@CDDCCCBBBBBB>BBBBBB?BCCCCCCCCCCCCCCCB<9>B
bbduk.sh output:
@SN1131:915:HFYN7ADXY:1:1101:21364:2052 1:N:0: CAACCACA
TTTCNCCACCACCACGTCGTTCTTGCGCCTCTTCTTGGCTTTCCGCTTGCG
+
@@@B!2=BFHFHHII<GHIIIHIIIBHIIIIIIIIIIIIGIIIGIIIIIII
Thank you,
Brian
Comment
-
Hi Brian,
That's intentional. The 5th base call is an N, which means the quality score should be 0 (!) not 2 (#). Some versions of Illumina software have bugs causing some Ns to be assigned quality scores above 0, or called bases to be assigned a quality score of 0. Neither of these cases should happen as they are mathematically contradictory, and can cause problems with downstream tools, so BBDuk automatically fixes both of them.
You can add the flag "changequality=f" to disable this behavior, but I don't recommend it.
Comment
-
This behaviour is a bit un-Unix like?
bbduk.sh in1=R1.fq.gz in2=R2.fq.gz loglog loglogk=31 out=/dev/null
Unspecified format for output /dev/null; defaulting to fastq.
Exception in thread "main" java.lang.AssertionError: /dev/null already exists; please delete it.
Comment
-
@Brian will have a more official answer but BBTools are pure Java and are coded to be OS agnostic (will run on any OS with Java).Originally posted by Torst View PostThis behaviour is a bit un-Unix like?
Not specifying an "out" option with most BBTools produces all statistics without result output (giving you out=/dev/null effect).
Comment
-
Haha
The syntax would be:
bbduk.sh in1=R1.fq.gz in2=R2.fq.gz loglog loglogk=31 out=stdout.fq > /dev/null/
But, you don't need to specify anything, as the default is to not print anything rather than writing to stdout, so just do this:
bbduk.sh in1=R1.fq.gz in2=R2.fq.gz loglog loglogk=31
Edit: @Genomax beat me by a minute
Comment
-
Getting different results with bbduk command line vs geneious plugin
Hi,
I have been searching the default settings in the command line and still haven't identified the source of the discrepancy... Here is my linux command:
sh ~/bbmap/bbduk.sh in1=~/path/to/forwards.fastq.gz in2=~/path/to/reverses.fastq.gz out=~/path/to/output.fastq.gz ref=~/bbmap/resources/adapters.fa ktrim=r k=23 mink=11 hdist=1 minoverlap=24 tbo
result: 3628348 reads, 581467350 bases
and here is my plugin command from the geneious output:
java.exe -ea -Xmx100m -cp ...\currenjgi.BBDukF ktrim=r k=23 hdist=1 edist=0 mink=11 ref=adapters.fa minlength=10 trimbyoverlap=t minoverlap=24 qin=33 in=input1.fastq in2=input2.fastq out=output1.fastq out2=output2.fastq
result: 3628348 reads, 584214527 bases
the plugin command seems compatible with my data and the defaults in bbduk.sh. Any idea why 3M more bases in the plugin?
Thanks, Aaron
Comment
Latest Articles
Collapse
-
by SEQadmin2
Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.
We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing...-
Channel: Articles
-
-
by SEQadmin2
The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.
This convergence of genetics, immunology, and computation...-
Channel: Articles
09-01-2026, 05:41 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, Today, 09:51 AM
|
0 responses
7 views
0 reactions
|
Last Post
by SEQadmin2
Today, 09:51 AM
|
||
|
Started by SEQadmin2, 09-25-2026, 09:06 AM
|
0 responses
31 views
0 reactions
|
Last Post
by SEQadmin2
09-25-2026, 09:06 AM
|
||
|
Started by SEQadmin2, 09-23-2026, 11:05 AM
|
0 responses
26 views
0 reactions
|
Last Post
by SEQadmin2
09-23-2026, 11:05 AM
|
||
|
Started by SEQadmin2, 09-18-2026, 11:37 AM
|
1 response
47 views
0 reactions
|
Last Post
by pekgio
09-21-2026, 02:04 AM
|
Comment