Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • statsteam
    Member
    • Sep 2009
    • 19

    #1

    tophat2 some parameters are not working (--no-novel-indels and -a)

    I used tophat2 to map reads with --no-novel-indels and -a 6 parameters. Once the mapping is done, I examined the result (accepted_hits.bam) and found some lines with indels or some lines whose anchor length < 6.

    ## with insertion
    SRR074943.46688543 369 chr1 10178 0 21M2I27M chr14 69256332 0 CCTAACCCTAACCCTAACCCTAAAACCCTAACCCTAACCCTAACCCTAAC <<;@=ABA=A=BAB7B8B>B?ABA=BBB4B8BBB<B8BBC?B=BBCABBB AS:i:-11 XN:i:0 XM:i:0 XO:i
    :1 XG:i:2 NM:i:2 MD:Z:48 YT:Z:UU NH:i:16 CC:Z:= CP:i:10184 HI:i:0


    ## anchor length < 6
    SRR074943.63823907 329 chr1 14825 0 5M140N45M * 0 0 GATGCCCTTGCGCCTCATGACCAGCTTGTTGAAGAGATCCGATATCAAGT BBBBBBBBBB?A@@B@>BB?:><<?@@?=?<:9@<6:=65:?:7:=:=4, AS:i:-4 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:42C7 YT:Z:UU XS:A:- NH:i:7 CC:Z:c
    hr15 CP:i:102516151 HI:i:0


    There are a lot of lines like these. I am wondering if anyone else had the same problem as this or I did something wrong in running tophat.

    This is the command line I used to run tophat2

    tophat -o tophat_out -N 3 -r 30 --mate-std-dev 110 -a 6 -I 300000 -p 8 -g 20 --no-novel-indels --no-coverage-search hg19_index read_1.fastq read_2.fastq

    Thank you!
    Last edited by statsteam; 05-28-2014, 03:48 PM. Reason: putting a correct example for anchor length <6
  • statsteam
    Member
    • Sep 2009
    • 19

    #2
    I figured out -a 6 parameter issue. It does not ensure individual read to have at least x bps on each side of junction. Instead, it ensures that each junction to have at least one read that meet the anchor condition. If -a 6 is used, each junction must have reads that spans at least 6bps on each side of junction.

    I still do not know why --no-novel-indels does not work.

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
      by SEQadmin2



      CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

      Despite this, “CRISPR helped turn genome editing from a specialized technique into
      ...
      07-31-2026, 11:01 AM
    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      07-20-2026, 11:48 AM
    • SEQadmin2
      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
      by SEQadmin2



      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
      ...
      07-09-2026, 11:10 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, 07-31-2026, 02:55 AM
    0 responses
    18 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-24-2026, 12:17 PM
    0 responses
    16 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-23-2026, 11:41 AM
    0 responses
    16 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-20-2026, 11:10 AM
    0 responses
    26 views
    0 reactions
    Last Post SEQadmin2  
    Working...