Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • ncbi-blast

    Hi,

    I have a trialseq.fa file having a sequence:

    >trialseq
    TGGCCTAACCTTCGGGAAGGAGCCGTCTAAGGCAGGGCAGATGACNNNNNNNNNNNNGTAACAAGNNNNNNNNNNNNGAACCTGNNNNNNGATCACCTCCTTTCTA

    There is also a blast db having the same sequence:
    makeblastdb -in trialseq.fa -dbtype nucl -out trial.db

    The trialseq has been blasted agains the DB:
    blastn -db trial.db -query trialseq.fa -out blast.txt

    However, blast result show only a partial match:

    ----
    Score = 84.2 bits (45), Expect = 4e-22
    Identities = 45/45 (100%), Gaps = 0/45 (0%)
    Strand=Plus/Plus

    Query 1 TGGCCTAACCTTCGGGAAGGAGCCGTCTAAGGCAGGGCAGATGAC 45
    |||||||||||||||||||||||||||||||||||||||||||||
    Sbjct 1 TGGCCTAACCTTCGGGAAGGAGCCGTCTAAGGCAGGGCAGATGAC 45

    ----

    How to use blast in such a way that it would return true 100% match? So that N would match as any nucleotide.

    Thanks

  • #2
    Originally posted by sampie View Post
    Hi,

    I have a trialseq.fa file having a sequence:

    >trialseq
    TGGCCTAACCTTCGGGAAGGAGCCGTCTAAGGCAGGGCAGATGACNNNNNNNNNNNNGTAACAAGNNNNNNNNNNNNGAACCTGNNNNNNGATCACCTCCTTTCTA

    There is also a blast db having the same sequence:
    makeblastdb -in trialseq.fa -dbtype nucl -out trial.db

    The trialseq has been blasted agains the DB:
    blastn -db trial.db -query trialseq.fa -out blast.txt

    However, blast result show only a partial match:

    ----
    Score = 84.2 bits (45), Expect = 4e-22
    Identities = 45/45 (100%), Gaps = 0/45 (0%)
    Strand=Plus/Plus

    Query 1 TGGCCTAACCTTCGGGAAGGAGCCGTCTAAGGCAGGGCAGATGAC 45
    |||||||||||||||||||||||||||||||||||||||||||||
    Sbjct 1 TGGCCTAACCTTCGGGAAGGAGCCGTCTAAGGCAGGGCAGATGAC 45

    ----

    How to use blast in such a way that it would return true 100% match? So that N would match as any nucleotide.

    Thanks
    have you tried modifying Query filtering options?

    Code:
    -dust <String>
       Filter query sequence with DUST (Format: 'yes', 'level window linker', or
       'no' to disable)
       Default = `20 64 1'
     -filtering_db <String>
       BLAST database containing filtering elements (i.e.: repeats)
     -window_masker_taxid <Integer>
       Enable WindowMasker filtering using a Taxonomic ID
     -window_masker_db <String>
       Enable WindowMasker filtering using this repeats database.
     -soft_masking <Boolean>
       Apply filtering locations as soft masks
       Default = `true'
     -lcase_masking
       Use lower case filtering in query and subject sequence(s)?

    Comment


    • #3
      Hi,

      It seems it might be possible to get blast to work for some data set by trying various parameters. However, I contacted ncbi support and they told that handling ambiguous matches is not the strong suite of BLAST.

      So, I quess it is better to just try to find a local aligner which does support ambiguous matches.

      Any suggestions for a good local aligner for this purpose?

      Thanks

      Comment


      • #4
        with fasta package you can align local-local, local-global, global-global

        http://fasta.bioch.virginia.edu/fast...sta_down.shtml

        Comment


        • #5
          Thanks for suggestion.

          How about bowtie2? It seem to be quite popular and good tools. From bowtie2 help I found that it can be disabled that N is considered as a negatively scoring match. However, I did not find an option to have N as positively scoring match.

          Comment


          • #6
            My experience with Bowtie2 is limited to map Illumina reads to reference genome.
            have in mind that bowtie output is in sam format.

            Comment

            Latest Articles

            Collapse

            • seqadmin
              Exploring the Dynamics of the Tumor Microenvironment
              by seqadmin




              The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
              07-08-2024, 03:19 PM
            • seqadmin
              Exploring Human Diversity Through Large-Scale Omics
              by seqadmin


              In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
              06-25-2024, 06:43 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by seqadmin, Yesterday, 06:53 AM
            0 responses
            12 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 07-10-2024, 07:30 AM
            0 responses
            34 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 07-03-2024, 09:45 AM
            0 responses
            204 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 07-03-2024, 08:54 AM
            0 responses
            213 views
            0 likes
            Last Post seqadmin  
            Working...
            X