Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • ncbi-blast

    Hi,

    I have a trialseq.fa file having a sequence:

    >trialseq
    TGGCCTAACCTTCGGGAAGGAGCCGTCTAAGGCAGGGCAGATGACNNNNNNNNNNNNGTAACAAGNNNNNNNNNNNNGAACCTGNNNNNNGATCACCTCCTTTCTA

    There is also a blast db having the same sequence:
    makeblastdb -in trialseq.fa -dbtype nucl -out trial.db

    The trialseq has been blasted agains the DB:
    blastn -db trial.db -query trialseq.fa -out blast.txt

    However, blast result show only a partial match:

    ----
    Score = 84.2 bits (45), Expect = 4e-22
    Identities = 45/45 (100%), Gaps = 0/45 (0%)
    Strand=Plus/Plus

    Query 1 TGGCCTAACCTTCGGGAAGGAGCCGTCTAAGGCAGGGCAGATGAC 45
    |||||||||||||||||||||||||||||||||||||||||||||
    Sbjct 1 TGGCCTAACCTTCGGGAAGGAGCCGTCTAAGGCAGGGCAGATGAC 45

    ----

    How to use blast in such a way that it would return true 100% match? So that N would match as any nucleotide.

    Thanks

  • #2
    Originally posted by sampie View Post
    Hi,

    I have a trialseq.fa file having a sequence:

    >trialseq
    TGGCCTAACCTTCGGGAAGGAGCCGTCTAAGGCAGGGCAGATGACNNNNNNNNNNNNGTAACAAGNNNNNNNNNNNNGAACCTGNNNNNNGATCACCTCCTTTCTA

    There is also a blast db having the same sequence:
    makeblastdb -in trialseq.fa -dbtype nucl -out trial.db

    The trialseq has been blasted agains the DB:
    blastn -db trial.db -query trialseq.fa -out blast.txt

    However, blast result show only a partial match:

    ----
    Score = 84.2 bits (45), Expect = 4e-22
    Identities = 45/45 (100%), Gaps = 0/45 (0%)
    Strand=Plus/Plus

    Query 1 TGGCCTAACCTTCGGGAAGGAGCCGTCTAAGGCAGGGCAGATGAC 45
    |||||||||||||||||||||||||||||||||||||||||||||
    Sbjct 1 TGGCCTAACCTTCGGGAAGGAGCCGTCTAAGGCAGGGCAGATGAC 45

    ----

    How to use blast in such a way that it would return true 100% match? So that N would match as any nucleotide.

    Thanks
    have you tried modifying Query filtering options?

    Code:
    -dust <String>
       Filter query sequence with DUST (Format: 'yes', 'level window linker', or
       'no' to disable)
       Default = `20 64 1'
     -filtering_db <String>
       BLAST database containing filtering elements (i.e.: repeats)
     -window_masker_taxid <Integer>
       Enable WindowMasker filtering using a Taxonomic ID
     -window_masker_db <String>
       Enable WindowMasker filtering using this repeats database.
     -soft_masking <Boolean>
       Apply filtering locations as soft masks
       Default = `true'
     -lcase_masking
       Use lower case filtering in query and subject sequence(s)?

    Comment


    • #3
      Hi,

      It seems it might be possible to get blast to work for some data set by trying various parameters. However, I contacted ncbi support and they told that handling ambiguous matches is not the strong suite of BLAST.

      So, I quess it is better to just try to find a local aligner which does support ambiguous matches.

      Any suggestions for a good local aligner for this purpose?

      Thanks

      Comment


      • #4
        with fasta package you can align local-local, local-global, global-global

        http://fasta.bioch.virginia.edu/fast...sta_down.shtml

        Comment


        • #5
          Thanks for suggestion.

          How about bowtie2? It seem to be quite popular and good tools. From bowtie2 help I found that it can be disabled that N is considered as a negatively scoring match. However, I did not find an option to have N as positively scoring match.

          Comment


          • #6
            My experience with Bowtie2 is limited to map Illumina reads to reference genome.
            have in mind that bowtie output is in sam format.

            Comment

            Latest Articles

            Collapse

            • seqadmin
              The Impact of AI in Genomic Medicine
              by seqadmin



              Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
              02-26-2024, 02:07 PM
            • seqadmin
              Multiomics Techniques Advancing Disease Research
              by seqadmin


              New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

              A major leap in the field has
              ...
              02-08-2024, 06:33 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by seqadmin, Yesterday, 06:12 AM
            0 responses
            20 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 02-23-2024, 04:11 PM
            0 responses
            67 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 02-21-2024, 08:52 AM
            0 responses
            75 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 02-20-2024, 08:57 AM
            0 responses
            66 views
            0 likes
            Last Post seqadmin  
            Working...
            X