Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • mcoyne
    replied
    I tripped over something to get around the merging problem in bbmerge described above...

    Merging fastq reads with bbmerge does trim the merge, resulting in only retaining the overlapping part, however -- if I first turn the fastq reads into fasta reads and interleave them, it produces the desired output:

    Code:
    Checking output:
    
    First two reads from interleaved file:
    
    >LH00315.67.22H3LVLT3.1.1101.5558.1048.R1 1:N:0:ACTTCCGG+GACCAATT
    GGGACTGTGGCCGTCGACCTGCAGCGTACGGGAATACCTGTTGATATTTAAGAGACCTCGTGGACATCTA
    TCCCCTATAGTGAGTCGTATTACCTGCAGGGCGTAATG
    >LH00315.67.22H3LVLT3.1.1101.5558.1048.R2 2:N:0:ACTTCCGG+GACCAATT
    TCGGACCAACTAAGCTGGCGGGACTCTGGGGTTCGCGACACTGGCAGAGCATTACGCCCTGCAGGTAATA
    CGACTCACTATAGGGGATAGATGTCCACGAGGTCTCTT
    
    
    >2nd read RC
    AAGAGACCTCGTGGACATCTATCCCCTATAGTGAGTCGTATTACCTGCAGGGCGTAATGCTCTGCCAGTGT
    CGCGAACCCCAGAGTCCCGCCAGCTTAGTTGGTCCGA
    
    Blast alignment:
    
    Query  50 AAGAGACCTCGTGGACATCTATCCCCTATAGTGAGTCGTATTACCTGCAGGGCGTAATG 108
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
    Sbjct 108 AAGAGACCTCGTGGACATCTATCCCCTATAGTGAGTCGTATTACCTGCAGGGCGTAATG 50
    
    Manual alignment:
    
    GGGACTGTGGCCGTCGACCTGCAGCGTACGGGAATACCTGTTGATATTTaagagacctcgtggacatctatcccctatagtgagtcgtattacctgcagggcgtaatg
                                                     aagagacctcgtggacatctatcccctatagtgagtcgtattacctgcagggcgtaatgCTCTGCCAGTGTCGCGAACCCCAGAGTCCCGCCAGCTTAGTTGGTCCGA
    
    Expected sequence (157 bp):
    GGGACTGTGGCCGTCGACCTGCAGCGTACGGGAATACCTGTTGATATTTaagagacctcgtggacatctatcccctatagtgagtcgtattacctgcagggcgtaatgCTCTGCCAGTGTCGCGAACCCCAGAGTCCCGCCAGCTTAGTTGGTCCGA
    
    BBMerge output (157 bp):
    
    >LH00315.67.22H3LVLT3.1.1101.5558.1048.R1 1:N:0:ACTTCCGG+GACCAATT
    GGGACTGTGGCCGTCGACCTGCAGCGTACGGGAATACCTGTTGATATTTAAGAGACCTCGTGGACATCTA
    TCCCCTATAGTGAGTCGTATTACCTGCAGGGCGTAATGCTCTGCCAGTGTCGCGAACCCCAGAGTCCCGC
    CAGCTTAGTTGGTCCGA

    Not sure if combining the R1 and R2 fastq files into a single interleaved file before running bbmerge, or if producing two fasta files rather than one interleaved fasta file will have the same effect.

    Leave a comment:


  • ghimbikal
    replied
    Hi, I am new to programming and bioinformatics. I am having trouble merging my fastq files with the inclusion of the overhangs/nonoverlapping reads at either end. I tried PEAR before, which gave me final consensus only for the overlapping region. I tried bbmerge and it gave me the same thing. And I am not able to figure out what script I should use to have the final consensus that includes overhangs added to ends of my consensus so I have the full consensus sequences. For example, I have following fastq reads. Could any expert help me with a custom script for this? thanks.

    @S1_A01_015_F
    ATTTATTTTTGGTGCTTTTTCTGGTGTAGTAGGAACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATTTTTGCTGGGAATCATCATTTATATAATGTTGTTGTTACAGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATAGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACTGTATATCCTCCTTTATCAAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACTGCTTTTTTATTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAACTTAAATACATCTTTTTACGATCCATCAGGCGGAGGAGATCCTGTATTATACCAACATTTATTTTGGTTTTTCGGCAACCCCGGAAG
    +
    9>*%**ROOAB*,78K[[[[W>W:0G6J@RP_J__Y_TPK_W_MRP\\__\\__\\\_W;W___\_\W___\__________\___W____\\_W____\___\_________WK__RW____\__\__________RKWWW__RW__W_WRW________________WWWW_\YW___WWWW______WW_WWW_____W_________________\S______LRRW_____Y____________\_W_________________________________\__________________W________________________________WRRWWW___________________________________________________\_____________________________________________RRR_____________________O_____________________________________________________[[[[R[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[WW[[[[[[[[[[[[[[[[[[[[[R[[[[[[W[T[[[[[[[[[[[[R[[[[[[W[[R[[[MQ[[SO[W[LJB[[HMLWRT[[UPRSSSSJ=ISLM[ISIHKSS>@[IDD''&&&&*<A5-*((5

    @S1_A01_015_R
    CTCCTCGCCTGATGGATCGTAAAAGATGTATTTAAGTTTCTATCAGTTAATAACATAGTAATTGCACCAGCTAATACAGGTAAAGTTAATAATAATAAAAAAGCAGTAATAAATATAGCCCAAACAAATAAAGGTAATCTATGAAAACTTAAACCTGGAGCTCTCATATTATAAATAGTAGATAAAAAATTAATAGCACCTAATAAAGAAGAAATACCTGATAAATGTAAACTAAAAATAGCTAAATCTACTGAAGGACCTGAATGTGCTTGTACACTTGATAAAGGAGGATATACAGTCCAACCAGTACCTGCACCTGATTCAACAATAGCTGAAGAAACTAATAATAATAATGATGGTGGTAATAACCAAAAACTTATATTATTCATACGAGGAAAAGCCATATCTGGAGCACCAATCATTAAAGGTACAAACCAATTACCAAAACCACCTATTAAAACAGGCATAACCATAAAAAAAATCATAATAAATGCATGTGCTGTAACAACAACATTATATAAATGATGATTCCCAGCAAAAATTTGATTACCGGGTTGTGCTAATTCCATTCTAATTAAAACAGATAATGTAGTTCCTACTACACCAGAAAAAGCACCAAAAATTAAATATAAAGTACCTATGTCTTTATGATTTGTTGAAAA
    +
    B*+'2+(0C2W:0[C4'L4(*'*)/=1:?HJ[J<=7____HH_GJI_FS_Y__PP_R___TN_\\T_\M\_\_\\_\OY__\_\_______RR__\_________\__W______\OSYYW_Y___\\\\YCLW_____W_\WW\______\\\\Y_YWYWW___Y\_______W_\SAG<KQY_WRW_____YWQWY\_O\\EYYQN_WC_\Y___\Y_\\__\___\\\_\_\_____Y__\_\__\__YWW_Y_\__\_WQY_Y_Y___\\_\_Y__KYYWLLW_SWWO\___OY\_\Y____\_______\____\__________YYLLWQE_\\___R_____\\\YMYYOOY___________YYYYY\\OOY\\\________N_SRFG__Y\\YYY_YORR_Y__Y__YR___YYYOY__________Y____LYY_OO_Y_____L_Y___YY_________O______________YYLJOYH?=OL___________MU_U___________[NUNMOUURWOQUUUPIIW[OMWOU7?OUUUPWU[[[UUN[WNLW[[WWUWNMU[[U[U[UDLC[QSHRWRSPWQMPQS[VTS[JJPPS[TTTT[[[PQR[[[[[RRJHMRTQQRR[W[R[[LQQSW@MLA9J1QQKL
    ​​
    could any expert provide me a custom script for this two fastq files to merge so i get full lenght consensus?

    I used the command
    # Construct the BBMerge command with options to not trim the overhangs
    bbmerge_cmd = f'bbmerge.sh in1={forward_file} in2={reverse_file} out={output_file} outu={output_file}_unmerged.fastq ' \
    f'qtrim=f qtrim2=f trimq=0 tbo=f tno=f usequality=f forcetrimleft=0 forcetrimright=0 forcetrimright2=0 forcetrimmod=0'​

    But still it gave me output by trimming the overlapped region as output as below:
    @S1_A01_015
    TTTAATTTTTGGTGCTTTTTCTGGTGTAGTAGGAACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATTTTTGCTGGGAATCATCATTTATATAATGTTGTTGTTACAGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATAGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACTGTATATCCTCCTTTATCAAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACTGCTTTTTTATTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAACTTAAATACATCTTTTTANGATCCANCAGGCGGAGG

    But i wanted the consensus as

    TTTTCAACAAATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCTGGTGTAGTAGGAACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATTTTTGCTGGGAATCATCATTTATATAATGTTGTTGTTACAGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATAGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACTGTATATCCTCCTTTATCAAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACTGCTTTTTTATTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAACTTAAATACATCTTTTTANGATCCANCAGGCGGAGGATCCTGTATTATACCAACATTTATTTTGGTTTTTCGGCAACCCCGGAAG​​
    Last edited by ghimbikal; 02-21-2024, 05:54 AM.

    Leave a comment:


  • kubu4
    replied
    Originally posted by Emily Shrimpton View Post
    Hi Brian,

    I'm trying to use your BBMerge program on my trimmed miRNA PE reads, but I am getting a very low merge rate. I looked at the files that had sequences unable to merge to try to understand what the problem could be, but I'm confused because there were sequences that match and could have been merged. (Please refer to the below comparison of the R1 and R2 sequences from the unmergeable files.) Could you provide some insight as to why this might be happening?

    [login001: ~]$ head mirna4Merged/14343_003_R1_fastx_trimmer_NOT_MERGED_output.fastq
    @A00672:72:HNTG5DSX2:4:1101:24198:13369 1:N:0:AAGTACAG
    TTCAAGTAATCCAGGATAGGC
    +
    FFFFFFFFFFFFFFFFFFFFF
    @A00672:72:HNTG5DSX2:4:1101:24795:13369 1:N:0:AAGTACAG
    TGAGGTAGTAGGTTGTGTGGTTT
    +
    FFFFFFFFFFFFFFFFFFFFFFF
    @A00672:72:HNTG5DSX2:4:1101:29351:13369 1:N:0:AAGTACAG
    TATTGCACTCGTCCCGGCCTCC
    [login001: ~]$
    [login001: ~]$
    [login001: ~]$
    [login001: ~]$ head mirna4Merged/14343_003_R2_fastx_trimmer_NOT_MERGED_output.fastq
    @A00672:72:HNTG5DSX2:4:1101:24198:13369 2:N:0:AAGTACAG
    GCCTATCCTGGATTACTTGAA
    +
    FFFFFFFFFFFFFFFFFFFFF
    @A00672:72:HNTG5DSX2:4:1101:24795:13369 2:N:0:AAGTACAG
    AAACCACACAACCTACTACCTCA
    +
    FFFFFFFFFFFFFFFFFFFFFFF
    @A00672:72:HNTG5DSX2:4:1101:29351:13369 2:N:0:AAGTACAG
    GGAGGCCGGGACGAGTGCAATA

    Thank you for your time!
    Emily Shrimpton

    Edit: RESOLVED
    Emily Shrimpton - Would you be willing to post how you resolved this (if you still remember)? Thanks!

    Leave a comment:


  • mcoyne
    replied
    Hi all --

    I'm having trouble with BBMerge, from 38.90...

    Given two fastq reads, adapter trimmed, pre-merge:

    Code:
    r1:
    @M08540:24:000000000-KVP7W:1:1101:14796:2333 1:N:0:AGCGATAG+TAATCTTA
    TACTTTGCGAGATGCCCTAAGCTGGCGGGACTCTGGGGTTCGCGACACTGGCAGAGCATTACGCCCTGCAGGTAATACGACTCACTATAGGGGATAGATGTCCACGAggtctctATCATGCGGCTTTTAACAATCGTACGCTGCAGGTCGACAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAG
    +
    CCCCCFFFCCCCGGGGGGGGGGHHHGGGGGGHHHHHHGEEHGGGGGGGFHHHHGGHHHHHHHGGGGGHHHHHHHHHHHHFEGGHHHHHHHHHGGGHHHHHHHHHHGGGGGHHHHHHHHHHHGGGGGHHHHHHHHHGHHHGGGGGHHHHHGGGGGGGGGGGGFGGGGGGGGGGFFFFFFFFFFFFFFFFFFFFFF
    
    r2:
    @M08540:24:000000000-KVP7W:1:1101:14796:2333 2:N:0:AGCGATAG+TAATCTTA
    GTCGACCTGCAGCGTACGATTGTTAAAAGCCGCATGATAGAGACCTCGTGGACATCTATCCCCTATAGTGAGTCGTATTACCTGCAGGGCGTAATGCTCTGCCAGTGTCGCGAACCCCAGAGTCCCGCCAGCTTAGGGCATCTCGCAAAGTAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCTCGGGGGTAGCTGGAGCATTAAAAAAGAAAAAGAGATGAGAGTAGAAG
    +
    BBBB@DBBFFFFGGGGGGCGGGHHHHHHGHHGGGGGHHGHHHHHGHHGHHGGGHHHHHHHHHGHGHHGHHHHHHGGHGHHHGHHHHHHGGGGGGGHHGHHHHHHHHHHHGHGFGGGGGGGHHHHHHGGGGGGHHHHHHHGHHHHHGGGGHGFHHHHHHGGGGHHHGGGGGG.BCFGC:9CCFCFFGGGGFFFGGB0CBFB00;/;.@@D-.;//;.9.9:9//;///-.::/.....9/////::;////
    The relationship between these two reads is (with r2 reverse-complemented, common region in lower case):

    Code:
    r1:                                                                                                         tactttgcgagatgccctaagctggcgggactctggggttcgcgacactggcagagcattacgccctgcaggtaatacgactcactataggggatagatgtccacgaggtctctatcatgcggcttttaacaatcgtacgctgcaggtcgacAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAG
    r2(rc):   CTTCTACTCTCATCTCTTTTTCTTTTTTAATGCTCCAGCTACCCCCGAGATCTACACTAATCTTAACACTCTTTCCCTACACGACGCTCTTCCGATCTtactttgcgagatgccctaagctggcgggactctggggttcgcgacactggcagagcattacgccctgcaggtaatacgactcactataggggatagatgtccacgaggtctctatcatgcggcttttaacaatcgtacgctgcaggtcgac
    My desired output is the merged read with all the data included, with no trimming on either end, i.e.:

    Code:
    CTTCTACTCTCATCTCTTTTTCTTTTTTAATGCTCCAGCTACCCCCGAGATCTACACTAATCTTAACACTCTTTCCCTACACGACGCTCTTCCGATCTtactttgcgagatgccctaagctggcgggactctggggttcgcgacactggcagagcattacgccctgcaggtaatacgactcactataggggatagatgtccacgaggtctctatcatgcggcttttaacaatcgtacgctgcaggtcgacAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAG
    BBMerge switches used (additional file input and output options are also included):

    qtrim=f qtrim2=f trimq=0 tbo=f tno=f usequality=f forcetrimleft=0 forcetrimright=0 forcetrimright2=0 forcetrimmod=0 forcemerge=t

    produces this merged output:

    Code:
    >M08540:24:000000000-KVP7W:1:1101:14796:2333 1:N:0:AGCGATAG+TAATCTTA
    TACTTTGCGAGATGCCCTAAGCTGGCGGGACTCTGGGGTTCGCGACACTGGCAGAGCATTACGCCCTGCA
    GGTAATACGACTCACTATAGGGGATAGATGTCCACGAGGTCTCTATCATGCGGCTTTTAACAATCGTACG
    CTGCAGGTCGAC
    In other words, it appears to be doing "trimbyoverlap" (tbo) even though it's explicitly set to off.

    Are there setting I can use that will produce the desired output (a 292 bp sequence, with no trimming on either end)?​

    Leave a comment:


  • Emily Shrimpton
    replied
    Hi Brian,

    I'm trying to use your BBMerge program on my trimmed miRNA PE reads, but I am getting a very low merge rate. I looked at the files that had sequences unable to merge to try to understand what the problem could be, but I'm confused because there were sequences that match and could have been merged. (Please refer to the below comparison of the R1 and R2 sequences from the unmergeable files.) Could you provide some insight as to why this might be happening?

    [login001: ~]$ head mirna4Merged/14343_003_R1_fastx_trimmer_NOT_MERGED_output.fastq
    @A00672:72:HNTG5DSX2:4:1101:24198:13369 1:N:0:AAGTACAG
    TTCAAGTAATCCAGGATAGGC
    +
    FFFFFFFFFFFFFFFFFFFFF
    @A00672:72:HNTG5DSX2:4:1101:24795:13369 1:N:0:AAGTACAG
    TGAGGTAGTAGGTTGTGTGGTTT
    +
    FFFFFFFFFFFFFFFFFFFFFFF
    @A00672:72:HNTG5DSX2:4:1101:29351:13369 1:N:0:AAGTACAG
    TATTGCACTCGTCCCGGCCTCC
    [login001: ~]$
    [login001: ~]$
    [login001: ~]$
    [login001: ~]$ head mirna4Merged/14343_003_R2_fastx_trimmer_NOT_MERGED_output.fastq
    @A00672:72:HNTG5DSX2:4:1101:24198:13369 2:N:0:AAGTACAG
    GCCTATCCTGGATTACTTGAA
    +
    FFFFFFFFFFFFFFFFFFFFF
    @A00672:72:HNTG5DSX2:4:1101:24795:13369 2:N:0:AAGTACAG
    AAACCACACAACCTACTACCTCA
    +
    FFFFFFFFFFFFFFFFFFFFFFF
    @A00672:72:HNTG5DSX2:4:1101:29351:13369 2:N:0:AAGTACAG
    GGAGGCCGGGACGAGTGCAATA

    Thank you for your time!
    Emily Shrimpton

    Edit: RESOLVED
    Last edited by Emily Shrimpton; 02-10-2023, 08:40 PM.

    Leave a comment:


  • GenoMax
    replied
    If you have two separate sequencing runs you can't "merge" the two reads since they are not sequencing the same fragment. Reason you can (in some cases) merge two reads R1/R2 to get a longer representation is because they are sequences from same fragment.

    Leave a comment:


  • yy273826987
    replied
    Can we merge two forward reads with this tool?

    Hi Brain,

    I am really new to bioinformatics data analysis and just found this wonderful tool. Here I have a question: I have several environmental samples (A, B, and C). I sequenced them (shotgun metagenoimcs sequencing; paired-end) and found that, for sample B, the sequencing depth is not high enough. So, I asked the sequencing center to sequence sample B again. In the end, I got two sets of sequencing results for sample B: B.R1, B.R2, B.2nd.R1, and B.2nd.R2. For my downstream analysis (e.g., co-assembly), do you think I should merge B.R1 and B.2nd.R1 first? If so, how can use BBmerge to do that? Based on my understanding, BBmerger is designed to merge R1 and R2. Can it be used to merge two sets of R1s (from two separate sequencing runs)? Or, is that merging even necessary?

    Thanks a lot!

    Yours,

    Leave a comment:


  • GenoMax
    replied
    @Shriram369: As long as your reads are in proper order in the files it would be fine to sub-set the data into manageable chunks and then do the merging.

    Leave a comment:


  • Shriram369
    replied
    Program ran out of memory on large dataset: Need some tips

    Hi folks,

    We have a shotgun metagenomic dataset (approx. 120Gbs compressed). I want to merge paired-end reads as longer reads will increase assembly performance. And I have tried it on a small subset of data and it remarkably increased N50 and scaffold length.

    But now I want to merged approx 120Gbs of compressed data for subsequent assembly. We have a system with 32 threads and 120Gb of memory. After going through tips on bbtools page, I tried following command and ran out of memory (Error message: This program ran out of memory.
    Try increasing the -Xmx flag and using tool-specific memory-related parameters).

    bbmerge-auto.sh in1=in_R1.fastq.gz in2=in_R2.fastq.gz out=merged.fastq.gz outu1=1_um.fastq.gz outu2=2_um.fastq.gz outa=adapters.txt ihist=insert_histogram.txt k=62 vstrict rem extend2=50 ecct mininsert=150 -Xmx80g minprob=0.8 prefilter=2 prealloc ziplevel=5

    My question are:

    1. Are there any other specific parameters with which it is manageable to run this command on mentioned configured server.

    2. Can I subset the data using partition.sh bbtools wrapper and run the command? But as I understand sub-setting the data will reduced merging of reads. is it true?

    Any tips/advice in this case is appreciated.

    Thanks

    Leave a comment:


  • ilya
    replied
    BBMerge guide recommends trimming adapters before merging -- but also, in a different place, recommends providing the adapter sequences to BBMerge. Which is best?

    Leave a comment:


  • GenoMax
    replied
    I would think so. I don't have first hand experience with mate pair reads but I recall that you need to switch one of the reads around.

    Leave a comment:


  • kokyriakidis
    replied
    Originally posted by GenoMax View Post
    Since notes on the page you linked say this:


    You should follow the steps that are denoted to replicate that functionality on the linked page.

    In general @Brian has recommended merging reads before doing any additional manipulations.
    In long pair mate reads I just do the splitNextera extra step? Otherwise the pipeline remains the same?

    Leave a comment:


  • GenoMax
    replied
    Since notes on the page you linked say this:
    There is a program “RQCFilter” which implements them as a pipeline, but that is not publically available because it has numerous hard-coded paths to reference datasets of contaminants.
    You should follow the steps that are denoted to replicate that functionality on the linked page.

    In general @Brian has recommended merging reads before doing any additional manipulations.

    Leave a comment:


  • kokyriakidis
    replied
    Source: https://jgi.doe.gov/data-and-tools/b...preprocessing/

    "These steps replicate the QA protocol implemented at JGI for Illumina reads. There is a program “RQCFilter” which implements them as a pipeline, but that is not publically available because it has numerous hard-coded paths to reference datasets of contaminants."

    It is in the bbtools files.

    Nevermind! 1) Is it a good plan to normalise and error correct first BEFORE merging? 2) Do I need to follow a different approach at trimming and filtering short vs long mate pair reads (Nextera)?
    Last edited by kokyriakidis; 07-08-2018, 12:15 PM.

    Leave a comment:


  • GenoMax
    replied
    Can you clarify which program you are referring to? I don't think there is a RQCfilter program in BBMap suite.

    Leave a comment:

Latest Articles

Collapse

  • seqadmin
    Best Practices for Single-Cell Sequencing Analysis
    by seqadmin



    While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
    06-06-2024, 07:15 AM
  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 06-14-2024, 07:24 AM
0 responses
12 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-13-2024, 08:58 AM
0 responses
14 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-12-2024, 02:20 PM
0 responses
17 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-07-2024, 06:58 AM
0 responses
186 views
0 likes
Last Post seqadmin  
Working...
X