FASTA file manipulations

[medinab]

Hello,

It might be a basic questions, but I was wondering about the best methods to manipulate FASTA files. My purpose is to extract Accession number and the sequence for every LSU from a fairly large database. I have tried working with it in Excel, but probably I need more advanced tools for that.

Thank you ,

Medina

[luc]

Hi Medina,

sorry, I do not fully understand what you are trying to accomplish. Seqtk, bbmap reformat, and grep might be tools that might help if interpret the drift of your questions correctly.

[bio_boris]

Try using biopython or bioperl, they have packages to read and extract bits of information from fasta files. It sounds like what you need can be achieved in a simple script.

Can you describe exactly what you need to do?

[medinab]

My project

Thank you guys for helping me,

I have downloaded a database that contains sequences for fungal large ribosomal subunits. The information provided in the database is too much, since all I need is an accession number for sequence and the sequence itself.

This is the provided info:

LOCUS S000415306 556 bp rRNA linear BCT 13-Oct-2004
DEFINITION Sparassis crispa; MAFF 238626.
ACCESSION AB177553 REGION: <1..>556
SOURCE Sparassis crispa
ORGANISM Sparassis crispa
Root; Fungi; Basidiomycota; Agaricomycetes; Polyporales;
Sparassidaceae; Sparassis.
REFERENCE 1 (bases 1 to 556)
AUTHORS Nagao H.;
TITLE ;
JOURNAL Submitted (16-APR-2004) to the EMBL/GenBank/DDBJ databases.
Hideyuki Nagao, National Institute of Agrobiological Science,
Microorganism Genebank; 2-1-2, Kannondai, Tsukuba, Ibaraki
305-8602, Japan (E-mail:[email protected], Tel:81-298-38-7060,
Fax:81-298-38-7058)
REFERENCE 2
AUTHORS Nagao H., Sato T., Kakishima M.;
TITLE Phylogenic analysis of the genus Exobasidium in Japan using ITS and
L-rDNA sequences
JOURNAL Unpublished.
COMMENT Genbank: AB177553 islowqual: false
FEATURES Location/Qualifiers
source 1..556
/country="Japan:Tochigi, Nasu, Yumoto, Yuzen-jinja"
/db_xref="taxon:139825"
/mol_type="genomic DNA"
/organism="Sparassis crispa"
/strain="MAFF 238626"
rRNA <1..>556
/note="large S rRNA"
/product="large subunit ribosomal RNA"
ORIGIN
1 agtaactgcg agtgaagcgg gaagagctca aatttaaaat ctggcggcgt cctcgtcgtc
61 cgagttgtaa tctggagaag cgacatccgc gctggaccgt gtacaagtct cttggaaaag
121 agcgtcgtag agggtgacaa tcccgtcttt gacacggacc gccagggctt tgtgatgcgc
181 tctcgatgag tcgagttgtt tgggaatgca gctcaaaatg ggtggtaaat tccatctaaa
241 gctaaatatt ggcgagagac cgatagcgaa caagtaccgt gagggaaaga tgaaaagaac
301 tttggaaaga gagttaaaca gtatgtgaaa tcgctgaaag ggaaacgctt gaagtcagtc
361 gcgtcggtcg gaattcagcc ttgctcacgc tcggtgtact ttctgaccga cgggtcagca
421 tcgattttga cggtcggata aaggtcgagg gaatgtggca ccttcgggtg tgttatagcc
481 ctcggttggg atacgacggt cgggatcgag gaaaaccggg cgctttcgcg tttgggatgc
541 tggcataatg gcttta


And all I need is :
AB177553 agtaactgcg agtgaagcgg gaagagctca aatttaaaat ctggcggcgtcctcgtcgtccgagttgtaatctggagaag cgacatccgc gctggaccgt gtacaagtct cttggaaaagagcgtcgtag agggtgacaa tcccgtcttt gacacggacc gccagggctt tgtgatgcgctctcgatgag tcgagttgtt tgggaatgca gctcaaaatg ggtggtaaat tccatctaaagctaaatatt ggcgagagac cgatagcgaa caagtaccgt gagggaaaga tgaaaagaactttggaaaga gagttaaaca gtatgtgaaa tcgctgaaag ggaaacgctt gaagtcagtcgcgtcggtcg gaattcagcc ttgctcacgc tcggtgtact ttctgaccga cgggtcagcatcgattttga cggtcggata aaggtcgagg gaatgtggca ccttcgggtg tgttatagccctcggttggg atacgacggt cgggatcgag gaaaaccggg cgctttcgcg tttgggatgc tggcataatg gcttta

[mastal]

What database did you download this from?

The format looks very similar to GenBank/NCBI Nucleotide.

You can probably download files which have only the sequence,
in fasta format (.fna files), with the header lines containing the accession numbers, if you don't need the rest of the information.

Otherwise, as aready mentioned above, you can parse your files with Bioperl to extract the accession number and the sequence.