SOAPaligner problem: Query File Error: Can't read

[peromhc]

So what seems to be a super-easy problem has proved itself difficult to resolve. I've posted the the SOAP mailing list and to the contact email listed on the SOAP website...

Basically, I get this an error that seems to refer to the input fasta file..

The command:

macmanes@macmanes:~/soap-2.20$ ./soap -D /home/macmanes/soap-2.20/ 
tuco.fa.index –a /home/macmanes/soap-2.20/reads_a.fa -o /media/hd/tuco/mrna/ 
SOAP_results/soap

The painful results:

Begin Program SOAPaligner/soap2 
Fri Apr 16 12:51:34 2010 
Reference: /home/macmanes/soap-2.20/tuco.fa.index 
Query File Error: Can't read

Here are the reads:

macmanes@macmanes:~/soap-2.20$ head /home/macmanes/soap-2.20/reads_a.fa 

>1 
CAGATATCTTGGGGAGCTCCGGGCGTAGCAGGGTTGGGGAGCCGTGAGAGGGGGCGGCTGTCAGGGCCGGGTGGCACCGGGCGGGCGCGCGCCCGCCTGCCT 

>2 
CGGGAAGCGGGGAGCCTGAAGCTGGGGCCACCCCTCGCCGCCACCGGCGTGCAGCCGCCCAGGATTGCAGCCCGGAAGGGTCCCCCTGCAGGGGGTCTGGCG 

>3 
GTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAGCGCCGTTCCGACGGGACGGGACGACGGCCTCCGTCGCCCTCAGCCGC 

>4 
TGGGTCCCCATTAGAGGCGGTGAAATCGATGGCCACCGTGAAGCTGGTCTGGCAGCCGCCCCTGATGTAACCCAGAGACGGTGTGCACCTTTTCCACCGCGC 

>5 
GCCAGCCTGAACAACATCATGAGACTTTGTCTTGGGAGGCAAAAAGAGAAACTTAGACTATTCACATTAGAAATCAAGTAACAGAAACAACATCTCCATTCA

The error seems so elementary, yet, I have been unable to solve. The reads seems to be fine, and permissions are set appropriately.

Anybody know how to fix this problem?

[Pepe]

I haven't used SOAP, but I found once a software that did not like numbers as fasta headers.

[peromhc]

yeah, I dont think that's it: I've tried a few different input files, and none of them work.. All these are 101bp Illumina reads.. I wonder if SOAP can handle reads this long.

[baby1885]

SOAP2.20 can support fasta format

[peromhc]

SOAP2.20 can support fasta format

yeah, just not MY fasta I guess..

[Mansequencer]

Hi Peromhc,
Did you find a solution to your problem of SOAP2 not reading the file. In my case it seems to read the forward file just fine but when I try to do PE alignment, SOAP come with error Cannot write output file.
Any ideas,
Thanks.

[trummas]

Hi Everybody,
I ran into the same problem.
The solution was simple though, after some help from a friend :-). Make sure that the dashes for the command line are the right ones. They might not be if you copy the example on how to run it from the SOAP webpage. So just make sure that the "-" in front of a, D and o is the right one. If you look carefully on the example on the SOAP webpage the dash in front of the "a" is a "long dash". I just exchanged it and now it runs as it should.

Hope this helps.
Cheers,
Tomas

[jorgill]

I've been having the same problem, changed the short dash to long dash (guess all dashes are not born equal).
This changed my error message to a simple:
"Reference:
Query File Error: Can't read"