Unconfigured Ad

Collapse
This topic is closed.
X
X
 
  • Time
  • Show
Clear All
new posts
  • sridharacharya
    Member
    • May 2010
    • 24

    #346
    Thanks kmcarr!

    Comment

    • GenoMax
      Senior Member
      • Feb 2008
      • 7142

      #347
      @frymor's question is also posted (and possibly answered) on Biostars: https://www.biostars.org/p/167555/

      Comment

      • dpryan
        Devon Ryan
        • Jul 2011
        • 3478

        #348
        @GenoMax, good catch, I missed that it was posted here too.

        Comment

        • daanum
          Member
          • Nov 2015
          • 24

          #349
          Hi ,

          I am using a Linux GNU server. How can I view the.html files which are generated as a result of fastqc, on the linux server?
          Thank you.

          Comment

          • GenoMax
            Senior Member
            • Feb 2008
            • 7142

            #350
            Originally posted by daanum View Post
            Hi ,

            I am using a Linux GNU server. How can I view the.html files which are generated as a result of fastqc, on the linux server?
            Thank you.
            You don't have to view them on the server. The files are self contained and can be transferred to local desktop PC/Mac for stand-alone examination. That said you can use any browser available on the server to view them. On some clusters/servers admins insist on not installing browsers so downloading them locally may be the best option.

            Comment

            • dpryan
              Devon Ryan
              • Jul 2011
              • 3478

              #351
              Originally posted by GenoMax View Post
              You don't have to view them on the server. The files are self contained and can be transferred to local desktop PC/Mac for stand-alone examination.
              Indeed, probably the single nicest feature about FastQC is that the html files have the images embedded, making it really convenient to do this.

              Comment

              • apredeus
                Senior Member
                • Jul 2012
                • 151

                #352
                Hello Simon & all,

                first of all, I'd like to thank you for a fantastic tool - this is truly the most important tool for the most important step in whole NGS process, and it does its job fantastically well.

                second, I would like to ask if there is a collection of people's failed (or peculiar) results, obtained with FastQC and later explained. I've already seen https://sequencing.qcfail.com and I'm studying it right now, but it also seems that everybody would benefit from a wiki-like resource, where everybody can contribute (and discuss) the results. What do you think?

                Finally, I was curious about running Fastqc on IonTorrent results. It concerns me that the reads are all of different lengths & I never quite took the time to understand the exact math used in various Fastqc metrics (such as k-mer and overrepresented sequences evaluation). Thus if anything pops to anyone's mind about what sort of things to expect, what extra option to use, or what to do differently, I would greatly appreciate it.

                Comment

                • simonandrews
                  Simon Andrews
                  • May 2009
                  • 870

                  #353
                  Originally posted by apredeus View Post
                  Hello Simon & all,

                  first of all, I'd like to thank you for a fantastic tool - this is truly the most important tool for the most important step in whole NGS process, and it does its job fantastically well.

                  second, I would like to ask if there is a collection of people's failed (or peculiar) results, obtained with FastQC and later explained. I've already seen https://sequencing.qcfail.com and I'm studying it right now, but it also seems that everybody would benefit from a wiki-like resource, where everybody can contribute (and discuss) the results. What do you think?

                  Finally, I was curious about running Fastqc on IonTorrent results. It concerns me that the reads are all of different lengths & I never quite took the time to understand the exact math used in various Fastqc metrics (such as k-mer and overrepresented sequences evaluation). Thus if anything pops to anyone's mind about what sort of things to expect, what extra option to use, or what to do differently, I would greatly appreciate it.
                  QCFail is our attempt to provide some kind of collation of the types of failures we see in sequencing experiements, not just stuff you could spot with FastQC, but all through the analysis pipeline. We discussed a lot of different options for how to handle this (wikis, databases and various automated systems), but in the end since the number of failure modes is relatively limited we decided that the sort of tagged blog format + search was the most useful starting point. It may be that once we've got the system populated that we might look to find ways to direct people to relevant articles more easily so the information is more readily accessible when you see your problematic data, but that's something to work out in the future (unless anyone else fancies having a go!).

                  For your Ion Torrent data you shouldn't need to do anything different to work with that. For the overrepresented sequences we only take up to the first 50bp of each read anyway as we're using an exact matching strategy to count duplicates, so if you allow longer lengths then your results get increasingly messed up by mis-calls, and 50bp is normally enough to establish that it's the same sequence.

                  Comment

                  • apredeus
                    Senior Member
                    • Jul 2012
                    • 151

                    #354
                    Simon, thank you for your answer.

                    I will try to popularize the QCFail among our sequencing and bioinformatics community, so they would consider contributing some interesting cases as well.

                    Comment

                    • Roxana
                      Junior Member
                      • May 2017
                      • 3

                      #355
                      fastQC

                      Originally posted by simonandrews View Post
                      Aaargh - I'd forgotten that one of the other pending fixes for the next release was that the disable didn't work for the per-tile module (it will actually disable it if you turn of the adapter module as it was reading the wrong parameter).

                      I've just put up a development snapshot at http://www.bioinformatics.babraham.a...11.3_devel.zip which contains the fix for both of these issues. You should be able to use that to process these files.
                      Dear Simon, I have the same problem with my fastq file (from nanopore sequencing). Please, could you provide the link for download the fastQC version0.11.3 for Mac? Many thanks!!!

                      Comment

                      • GenoMax
                        Senior Member
                        • Feb 2008
                        • 7142

                        #356
                        Originally posted by Roxana View Post
                        Dear Simon, I have the same problem with my fastq file (from nanopore sequencing). Please, could you provide the link for download the fastQC version0.11.3 for Mac? Many thanks!!!
                        Currently available version is 0.11.5 (newer than this one) so it should have the fix in it. Can you try downloading that?

                        Comment

                        • Roxana
                          Junior Member
                          • May 2017
                          • 3

                          #357
                          Dear genoMax,
                          I tried to running in the version 0.11.5, but it is not working with my fastq file (from nanopore sequencing). Please, see below the error:
                          Code:
                          [rzz1@spectre14 ~]$ Picked up JAVA_TOOL_OPTIONS: -XX:MaxHeapSize=2048m
                          Exception in thread "Thread-1" java.lang.OutOfMemoryError: Java heap space
                          	at uk.ac.babraham.FastQC.Utilities.QualityCount.<init>(QualityCount.java:33)
                          	at uk.ac.babraham.FastQC.Modules.PerBaseQualityScores.processSequence(PerBaseQualityScores.java:141)
                          	at uk.ac.babraham.FastQC.Analysis.AnalysisRunner.run(AnalysisRunner.java:88)
                          	at java.lang.Thread.run(Thread.java:748)
                          my fastq file have the following structure:
                          Code:
                          @9157abfa-c2e8-4d54-a323-11162850dcbf runid=4243c40e101f8b1c6aa3337f2ef28b72eef6091c read=5 ch=78 start_time=2017-05-19T15:31:04Z
                          ATTTATGTTCTTGGCCCCCACACATTGTGGCCCCCATTGTTGTGTGTGTGTTATTTGACCCTTGTATTTGTATTGTTATTGTGTTATTGTTGGCCCCATTATTGTGTGTGTATTATTGTTATTTGACCCATTGTTGTATTGTGTGTGACTTGTGTGTGTGTATTATTGTTATTGTGTATTATTTGTGTGTGTGTGTGTGTGCTTGTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTCTCTATACTCTATATATATATACCTATATACTCTTCTTCTTCTTCTCTTCTTTCTCTCTTATGTCTTTCTCTTCTCTTCTTCTTATACCACTTCTTCTTCTATTCTAATAAATTAGGATGGGAGGAGGATGGATGGGTTCAAGGATAGTTCAATGAATACAAGGAGAGGAAAAAGGATC
                          +
                          $''$#&$&'$''""$$$$$#$#%%)+&)&%&(())'..')(%)&'$*&)#&+$(*('$%(')*%*"')+#'#*,$,*$*)%&%()#,(&1+('()('(+4'/*()$'#%#'#'+(./'.+$('(((,,,)08*,(#+',,(*'*'+*')0.)''*')%)%'"&&%(*#&'%*'%%#)#()).>-)++,*&(,,,+))'(%$&--&+.)+**)*+,,-++*-./22+,(,(-)*'.-.*)(&%,(%$),'($%%)%&%&)"*#'$*&&%%#$#%%%$'$%''*)&(,%('%(+&'$$&"$#%%&%&$(%$'"($&%*$'$''$'$'(%(+%($&%%&%%%&($'-$(+%&$%&#%%%%$&%##$%%$#$%$#$#$$##$####$$$#$##$$#$%$"$&#%$#"%&#%#%#$$&%&$%%%%&&%&$'#
                          This fastq file is a bit different from Illumina, and I am thinking that this fastq is not working in the last version of fastQC.
                          Many thanks for any advice.
                          Roxana
                          Last edited by GenoMax; 06-02-2017, 06:11 AM. Reason: Added [CODE] tags

                          Comment

                          • ewels
                            Phil Ewels
                            • Mar 2011
                            • 32

                            #358
                            Hi Roxana,

                            We've been debugging the same error earlier this afternoon, also with nanopore data. The error is because FastQC is running out of memory due to the long reads (I presume).

                            You can allocate more memory for FastQC by increasing the number of threads - it gets 250MB memory per thread. Our data worked when we ran with four threads:

                            Code:
                            fastqc -t 4 input.fastq
                            Phil

                            Comment

                            • Roxana
                              Junior Member
                              • May 2017
                              • 3

                              #359
                              Dear Ewels,
                              Many thanks for your advice. I used the following code and working very well. I increased the number of threads until 25.

                              code
                              fastqc -t 25 input.fastq

                              Roxana

                              Comment

                              • ewels
                                Phil Ewels
                                • Mar 2011
                                • 32

                                #360
                                Great, glad it worked!

                                Phil

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  New Genomics Technologies Take Aim at Long-Standing Limits
                                  by SEQadmin2


                                  Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.

                                  We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing
                                  ...
                                  Today, 10:25 AM
                                • SEQadmin2
                                  How Immunogenomics Decodes Immunity’s Genetic Blueprint
                                  by SEQadmin2




                                  The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

                                  This convergence of genetics, immunology, and computation...
                                  09-01-2026, 05:41 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, 09-25-2026, 09:06 AM
                                0 responses
                                27 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 09-23-2026, 11:05 AM
                                0 responses
                                24 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 09-18-2026, 11:37 AM
                                1 response
                                45 views
                                0 reactions
                                Last Post pekgio
                                by pekgio
                                 
                                Started by SEQadmin2, 09-16-2026, 10:23 AM
                                1 response
                                55 views
                                0 reactions
                                Last Post pekgio
                                by pekgio
                                 
                                Working...