Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Brian Bushnell
    Super Moderator
    • Jan 2014
    • 2709

    #16
    That's really strange. It actually should have worked fine whether you set it to t=4, t=8, or t=20, but at least it was successful now. Maybe an OS reinstall is not a bad idea.

    Comment

    • jstrohm
      Member
      • Aug 2014
      • 14

      #17
      Hi Brian,

      I tried to run BBmerge using this command: java -ea -Xmx200m -cp C:\Users\Jeff\Documents\Masters\bbmap\current\ jgi.BBMerge in=C:\Users\Jeff\Documents\Masters\bbmap\mapped_R1.fq out=merged_by_mapping.fq int usemapping parsecustom

      And it spit this at me without generating an output:

      BBMerge version 4.3
      Set INTERLEAVED to true
      Setting FASTQ.PARSE_CUSTOM to true
      Writing mergable reads merged.
      Started output threads.
      Note: Filename indicates non-synthetic data, but FASTQ.PARSE_CUSTOM=true
      Exception in thread "Thread-4" java.lang.AssertionError:
      Mismatch between length of bases and qualities for read 75 (id=412_chr1_0_157870
      44_15787280_-32_Glomeraceae_sp|EF558805|SH003500.06FU|reps_singleton|k__Fungi;p_
      _Glomeromycota;c__Glomeromycetes;o__Glomerales;f__Glomeraceae;g__unidentified;s_
      _Glomeraceae_sp /2).
      # qualities=412, # bases=229

      FGHHFGGFFGGHGFGHFFHEGGGGGHEHHHHHHGHHHHGEGGGGFHGGGGG@412_chr1_1_15787336_15787565
      _260_Glomeraceae_sp|EF558805|SH003500.06FU|reps_singleton|k__Fungi;p__Glomeromyc
      ota;c__Glomeromycetes;o__Glomerales;f__Glomeraceae;g__unidentified;s__@413_chr1_
      0_10703971_10704200_-32_Ascomycota_sp|FJ708614|SH229315.06FU|reps|k__Fungi;p__As
      comycota;c__unidentified;o__unidentified;f__unidentified;g__unidentified;s__Asco
      mycota_sp /2
      TTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGGCAAACCGAGCGTTAGCAAGGTTTTGCGATCAACTTATAT
      TTAAAACCCACTCTTTATATGTATATTTTTTATTTTGAATGATAATTAAAGATCACTTTCAACAACGGATCTCTTGGCTC
      TCGCATCGATGAAGAACGTAGCGACGTGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAA

      at stream.Read.<init>(Read.java:72)
      at stream.Read.<init>(Read.java:45)
      at stream.FASTQ.quadToRead(FASTQ.java:756)
      at stream.FASTQ.toReadList(FASTQ.java:620)
      at stream.FastqReadInputStream.fillBuffer(FastqReadInputStream.java:124)

      at stream.FastqReadInputStream.hasMore(FastqReadInputStream.java:80)
      at stream.ConcurrentGenericReadInputStream$ReadThread.readLists(Concurre
      ntGenericReadInputStream.java:739)
      at stream.ConcurrentGenericReadInputStream$ReadThread.run(ConcurrentGene
      ricReadInputStream.java:731)

      Comment

      • Brian Bushnell
        Super Moderator
        • Jan 2014
        • 2709

        #18
        Hmmm, it's working fine for me.

        I think the problem is that in your command line you are only specifying one pair for the merging. That's fine if the output from BBMap was interleaved, but not if output was in two files. Try this, instead:

        java -ea -Xmx200m -cp C:\Users\Jeff\Documents\Masters\bbmap\current\ jgi.BBMerge in1=C:\Users\Jeff\Documents\Masters\bbmap\mapped_R1.fq in2=C:\Users\Jeff\Documents\Masters\bbmap\mapped_R2.fq out=merged_by_mapping.fq usemapping parsecustom

        If that still does not work, please post the first 8 lines of each of the mapped files. It's possible that there is something odd in the headers that is messing with the parsing.

        Comment

        • jstrohm
          Member
          • Aug 2014
          • 14

          #19
          Ugh, sorry I made a sloppy copy/paste error. It worked!

          I looked at some quality stats for the final merged file in UPARSE and I noticed that instead of gaps separating the 5' and 3' fragments, there are N's.

          i.e. ATCGTCGAATGCNNNNNNNNNNNNNNCACATTACGAGTTAC

          This is making quality filtering impossible as UPARSE thinks every sequence is loaded with bad base calls. I thought of just doing a find/replace command to change N's to gaps but I'm afraid it may mess with the headers... What are your thoughts?

          Something else that I didn't consider is that since ITS1 is so length variable between taxa, the variable gap size will make end trimming everything to the same length difficult. UPARSE recommends doing this to prevent spurious OTUs.

          Anyway... thanks again for your help! Looks like it worked as advertized

          Comment

          • Brian Bushnell
            Super Moderator
            • Jan 2014
            • 2709

            #20
            Jeff,

            I suggest doing quality filtering prior to merging; otherwise the problem with the Ns will be inevitable. For example:
            java -ea -Xmx200m -cp /path/ jgi.ReformatReads in1=mapped1.fq in2=mapped2.fq out1=filtered1.fq out2=filtered2.fq maq=15

            ...where "maq" means "min average quality" (phred scaled) and reads with an average quality below that will be discarded. Pairs will be either discarded or retained together. Then just merge the filtered reads.

            Comment

            • jstrohm
              Member
              • Aug 2014
              • 14

              #21
              OK sounds good, I was worried that filtering prior to merging would change the read orders in the two files... complicating the merging process

              Comment

              • Illusive Man
                Member
                • Sep 2013
                • 15

                #22
                Originally posted by Brian Bushnell View Post
                I've uploaded a new version of BBTools; you can merge them like this:

                bbmap.sh -Xmx7g ref=reference.fa in=reads.fq outm=mapped.fq outu=unmapped.fq nodisk po int rbm don

                bbmerge.sh in=mapped.fq out=merged_by_mapping.fq int usemapping parsecustom

                bbmerge.sh in=unmapped.fq out=merged_by_overlap.fq outu=unmerged.fq int

                Then you can concatenate the merged_by_mapping.fq and merged_by_overlap.fq files to get a single file.

                Note that these commands all assume you are using a single interleaved file. For two files, you can use the "in1", "in2", "out1", and "out2" flags.
                Is this still the same workflow or is there a simpler process? I have amplicons that are about 634 bp in length, and have read1/read2 sequences that are about 300bp in length, hence there is about a ~34bp gap between read1/read2. I would like to merge them with the gaps but so far finding a piece of software that can do this has been very difficult.

                Comment

                • westerman
                  Rick Westerman
                  • Jun 2008
                  • 1104

                  #23
                  Originally posted by Illusive Man View Post
                  Is this still the same workflow or is there a simpler process? I have amplicons that are about 634 bp in length, and have read1/read2 sequences that are about 300bp in length, hence there is about a ~34bp gap between read1/read2. I would like to merge them with the gaps but so far finding a piece of software that can do this has been very difficult.
                  That workflow should still be valid (although I have not run it). Basically (1) map the reads, (2) merge the reads that map, (3) merge the reads that do not map. I do not think that the method could be made more simple.

                  Comment

                  • Illusive Man
                    Member
                    • Sep 2013
                    • 15

                    #24
                    BBMAP error?

                    Toms-Mac-Pro:bbmap tomhanks$ bash bbmap.sh -Xmx10g ref=amoa_archaea.fasta in1=Read1.fastq in2=Read2.fastq outm1=mapped_R1.fq outu1=unmapped_R1.fq outm2=mapped_R2.fq outu2=mapped_R2.fq nodisk po int rbm don
                    java -Djava.library.path=/Users/bubba/Downloads/bbmap/jni/ -ea -Xmx10g -cp /Users/bubba/Downloads/bbmap/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 -Xmx10g ref=amoa_archaea.fasta in1=Read1.fastq in2=Read2.fastq outm1=mapped_R1.fq outu1=unmapped_R1.fq outm2=mapped_R2.fq outu2=mapped_R2.fq nodisk po int rbm don
                    Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, -Xmx10g, ref=amoa_archaea.fasta, in1=Read1.fastq, in2=Read2.fastq, outm1=mapped_R1.fq, outu1=unmapped_R1.fq, outm2=mapped_R2.fq, outu2=mapped_R2.fq, nodisk, po, int, rbm, don]

                    BBMap version 35.85
                    Set INTERLEAVED to true
                    Retaining first best site only for ambiguous mappings.
                    Executing dna.FastaToChromArrays2 [amoa_archaea.fasta, 1, writeinthread=false, genscaffoldinfo=true, retain, waitforwriting=false, gz=true, maxlen=536670912, writechroms=false, minscaf=1, midpad=300, startpad=8000, stoppad=8000, nodisk=true]

                    Set genScaffoldInfo=true
                    Reset INTERLEAVED to false because paired input files were specified.
                    Set genome to 1

                    Loaded Reference: 0.005 seconds.
                    Loading index for chunk 1-1, build 1
                    Indexing threads started for block 0-1
                    Indexing threads finished for block 0-1
                    Generated Index: 0.481 seconds.
                    Analyzed Index: 4.322 seconds.
                    Started output stream: 0.016 seconds.
                    Started output stream: 0.001 seconds.
                    Cleared Memory: 0.147 seconds.
                    Processing reads in paired-ended mode.
                    Started read stream.
                    Started 8 mapping threads.
                    Exception in thread "Thread-8" Exception in thread "Thread-7" java.lang.AssertionError: Seems odd so I added this assertion. I don't see anywhere it was being used. Use -da flag to override.
                    at stream.FASTQ.customID(FASTQ.java:294)
                    at stream.FASTQ.toFASTQ(FASTQ.java:359)
                    at stream.Read.toFastq(Read.java:549)
                    at stream.ReadStreamByteWriter.writeFastq(ReadStreamByteWriter.java:429)
                    at stream.ReadStreamByteWriter.processJobs(ReadStreamByteWriter.java:90)
                    at stream.ReadStreamByteWriter.run2(ReadStreamByteWriter.java:41)
                    at stream.ReadStreamByteWriter.run(ReadStreamByteWriter.java:27)
                    java.lang.AssertionError: Seems odd so I added this assertion. I don't see anywhere it was being used. Use -da flag to override.
                    at stream.FASTQ.customID(FASTQ.java:294)
                    at stream.FASTQ.toFASTQ(FASTQ.java:359)
                    at stream.Read.toFastq(Read.java:549)
                    at stream.ReadStreamByteWriter.writeFastq(ReadStreamByteWriter.java:404)
                    at stream.ReadStreamByteWriter.processJobs(ReadStreamByteWriter.java:90)
                    at stream.ReadStreamByteWriter.run2(ReadStreamByteWriter.java:41)
                    at stream.ReadStreamByteWriter.run(ReadStreamByteWriter.java:27)
                    Exception in thread "Thread-11" java.lang.RuntimeException: Writing to a terminated thread.
                    at stream.ConcurrentGenericReadOutputStream.write(ConcurrentGenericReadOutputStream.java:198)
                    at stream.ConcurrentGenericReadOutputStream.addDisordered(ConcurrentGenericReadOutputStream.java:193)
                    at stream.ConcurrentGenericReadOutputStream.add(ConcurrentGenericReadOutputStream.java:97)
                    at align2.AbstractMapThread.writeList(AbstractMapThread.java:585)
                    at align2.AbstractMapThread.run(AbstractMapThread.java:551)
                    Detecting finished threads: 0Exception in thread "Thread-16" java.lang.RuntimeException: Writing to a terminated thread.
                    at stream.ConcurrentGenericReadOutputStream.write(ConcurrentGenericReadOutputStream.java:198)
                    at stream.ConcurrentGenericReadOutputStream.addDisordered(ConcurrentGenericReadOutputStream.java:193)
                    at stream.ConcurrentGenericReadOutputStream.add(ConcurrentGenericReadOutputStream.java:97)
                    at align2.AbstractMapThread.writeList(AbstractMapThread.java:585)
                    at align2.AbstractMapThread.run(AbstractMapThread.java:551)
                    Exception in thread "Thread-14" java.lang.RuntimeException: Writing to a terminated thread.
                    at stream.ConcurrentGenericReadOutputStream.write(ConcurrentGenericReadOutputStream.java:198)
                    at stream.ConcurrentGenericReadOutputStream.addDisordered(ConcurrentGenericReadOutputStream.java:193)
                    at stream.ConcurrentGenericReadOutputStream.add(ConcurrentGenericReadOutputStream.java:97)
                    at align2.AbstractMapThread.writeList(AbstractMapThread.java:585)
                    at align2.AbstractMapThread.run(AbstractMapThread.java:551)
                    Exception in thread "Thread-17" java.lang.RuntimeException: Writing to a terminated thread.
                    at stream.ConcurrentGenericReadOutputStream.write(ConcurrentGenericReadOutputStream.java:198)
                    at stream.ConcurrentGenericReadOutputStream.addDisordered(ConcurrentGenericReadOutputStream.java:193)
                    at stream.ConcurrentGenericReadOutputStream.add(ConcurrentGenericReadOutputStream.java:97)
                    at align2.AbstractMapThread.writeList(AbstractMapThread.java:585)
                    at align2.AbstractMapThread.run(AbstractMapThread.java:551)
                    Exception in thread "Thread-13" java.lang.RuntimeException: Writing to a terminated thread.
                    at stream.ConcurrentGenericReadOutputStream.write(ConcurrentGenericReadOutputStream.java:198)
                    at stream.ConcurrentGenericReadOutputStream.addDisordered(ConcurrentGenericReadOutputStream.java:193)
                    at stream.ConcurrentGenericReadOutputStream.add(ConcurrentGenericReadOutputStream.java:97)
                    at align2.AbstractMapThread.writeList(AbstractMapThread.java:585)
                    at align2.AbstractMapThread.run(AbstractMapThread.java:551)
                    Exception in thread "Thread-12" java.lang.RuntimeException: Writing to a terminated thread.
                    at stream.ConcurrentGenericReadOutputStream.write(ConcurrentGenericReadOutputStream.java:198)
                    at stream.ConcurrentGenericReadOutputStream.addDisordered(ConcurrentGenericReadOutputStream.java:193)
                    at stream.ConcurrentGenericReadOutputStream.add(ConcurrentGenericReadOutputStream.java:97)
                    at align2.AbstractMapThread.writeList(AbstractMapThread.java:585)
                    at align2.AbstractMapThread.run(AbstractMapThread.java:551)
                    , 1, 2, 3Exception in thread "Thread-15" java.lang.RuntimeException: Writing to a terminated thread.
                    at stream.ConcurrentGenericReadOutputStream.write(ConcurrentGenericReadOutputStream.java:198)
                    at stream.ConcurrentGenericReadOutputStream.addDisordered(ConcurrentGenericReadOutputStream.java:193)
                    at stream.ConcurrentGenericReadOutputStream.add(ConcurrentGenericReadOutputStream.java:97)
                    at align2.AbstractMapThread.writeList(AbstractMapThread.java:585)
                    at align2.AbstractMapThread.run(AbstractMapThread.java:551)
                    , 4, 5, 6Exception in thread "Thread-18" java.lang.RuntimeException: Writing to a terminated thread.
                    at stream.ConcurrentGenericReadOutputStream.write(ConcurrentGenericReadOutputStream.java:198)
                    at stream.ConcurrentGenericReadOutputStream.addDisordered(ConcurrentGenericReadOutputStream.java:193)
                    at stream.ConcurrentGenericReadOutputStream.add(ConcurrentGenericReadOutputStream.java:97)
                    at align2.AbstractMapThread.writeList(AbstractMapThread.java:585)
                    at align2.AbstractMapThread.run(AbstractMapThread.java:551)
                    , 7

                    **************************************************************************
                    Warning! 8 mapping threads did not terminate normally.
                    Check the error log; the output may be corrupt or incomplete.
                    Please submit the full stderr output as a bug report, not just this message.
                    **************************************************************************




                    ------------------ Results ------------------

                    Genome: 1
                    Key Length: 13
                    Max Indel: 16000
                    Minimum Score Ratio: 0.56
                    Mapping Mode: normal
                    Reads Used: 3600 (1064189 bases)

                    Mapping: 14.865 seconds.
                    Reads/sec: 242.19
                    kBases/sec: 71.59


                    Pairing data: pct reads num reads pct bases num bases

                    mated pairs: 5.0556% 91 5.0974% 54246
                    bad pairs: 0.0000% 0 0.0000% 0
                    insert size avg: 553.14


                    Read 1 data: pct reads num reads pct bases num bases

                    mapped: 5.0556% 91 5.0919% 27123
                    unambiguous: 5.0556% 91 5.0919% 27123
                    ambiguous: 0.0000% 0 0.0000% 0
                    low-Q discards: 0.0000% 0 0.0000% 0

                    perfect best site: 0.0000% 0 0.0000% 0
                    semiperfect site: 0.0000% 0 0.0000% 0
                    rescued: 0.0000% 0

                    Match Rate: NA NA 36.8918% 23738
                    Error Rate: 18.6858% 91 61.8649% 39807
                    Sub Rate: 18.6858% 91 4.0174% 2585
                    Del Rate: 8.4189% 41 57.8475% 37222
                    Ins Rate: 0.0000% 0 0.0000% 0
                    N Rate: 18.4805% 90 1.2433% 800


                    Read 2 data: pct reads num reads pct bases num bases

                    mapped: 5.0556% 91 5.0973% 27093
                    unambiguous: 5.0556% 91 5.0973% 27093
                    ambiguous: 0.0000% 0 0.0000% 0
                    low-Q discards: 0.1667% 3 0.0198% 105

                    perfect best site: 0.0000% 0 0.0000% 0
                    semiperfect site: 0.0000% 0 0.0000% 0
                    rescued: 0.0556% 1

                    Match Rate: NA NA 84.0296% 22788
                    Error Rate: 53.2164% 91 15.9335% 4321
                    Sub Rate: 53.2164% 91 15.6200% 4236
                    Del Rate: 7.6023% 13 0.0959% 26
                    Ins Rate: 9.9415% 17 0.2176% 59
                    N Rate: 0.5848% 1 0.0369% 10
                    Exception in thread "main" java.lang.RuntimeException: BBMap terminated in an error state; the output may be corrupt.
                    at align2.BBMap.testSpeed(BBMap.java:486)
                    at align2.BBMap.main(BBMap.java:33)
                    Last edited by Illusive Man; 03-13-2016, 10:53 AM.

                    Comment

                    • GenoMax
                      Senior Member
                      • Feb 2008
                      • 7142

                      #25
                      Can you add an explicit threads= option like below and try again:

                      Code:
                       $ bash bbmap.sh -Xmx10g threads=4 ref=amoa_archaea.fasta in1=Read1.fastq in2=Read2.fastq outm1=mapped_R1.fq outu1=unmapped_R1.fq outm2=mapped_R2.fq outu2=mapped_R2.fq nodisk po int rbm don overwrite=t
                      Last edited by GenoMax; 03-09-2016, 12:33 PM. Reason: correction to threads option

                      Comment

                      • Illusive Man
                        Member
                        • Sep 2013
                        • 15

                        #26
                        Originally posted by GenoMax View Post
                        Can you add an explicit threads= option like below and try again:

                        Code:
                         $ bash bbmap.sh -Xmx10g -threads=4 ref=amoa_archaea.fasta in1=Read1.fastq in2=Read2.fastq outm1=mapped_R1.fq outu1=unmapped_R1.fq outm2=mapped_R2.fq outu2=mapped_R2.fq nodisk po int rbm don overwrite=t
                        BBMap version 35.85
                        Exception in thread "main" java.lang.RuntimeException: Unknown parameter: -threads=4
                        at align2.AbstractMapper.parse(AbstractMapper.java:627)
                        at align2.AbstractMapper.<init>(AbstractMapper.java:51)
                        at align2.BBMap.<init>(BBMap.java:41)
                        at align2.BBMap.main(BBMap.java:29)

                        Comment

                        • GenoMax
                          Senior Member
                          • Feb 2008
                          • 7142

                          #27
                          Originally posted by Illusive Man View Post
                          BBMap version 35.85
                          Exception in thread "main" java.lang.RuntimeException: Unknown parameter: -threads=4
                          at align2.AbstractMapper.parse(AbstractMapper.java:627)
                          at align2.AbstractMapper.<init>(AbstractMapper.java:51)
                          at align2.BBMap.<init>(BBMap.java:41)
                          at align2.BBMap.main(BBMap.java:29)
                          My fault. Use threads=4 (no hyphen in front). I will edit the example above.

                          Comment

                          • Illusive Man
                            Member
                            • Sep 2013
                            • 15

                            #28
                            Originally posted by GenoMax View Post
                            My fault. Use threads=4 (no hyphen in front). I will edit the example above.
                            Thanks for your help! I tried that but it gave the same error unfortunately...
                            Exception in thread "main" java.lang.RuntimeException: BBMap terminated in an error state; the output may be corrupt.
                            at align2.BBMap.testSpeed(BBMap.java:486)
                            at align2.BBMap.main(BBMap.java:33)

                            Comment

                            • GenoMax
                              Senior Member
                              • Feb 2008
                              • 7142

                              #29
                              @Brian should be along later tonight and he will provide a definitive answer.

                              Comment

                              • Illusive Man
                                Member
                                • Sep 2013
                                • 15

                                #30
                                Originally posted by GenoMax View Post
                                @Brian should be along later tonight and he will provide a definitive answer.
                                Great! I look forward to hearing from him. I don't know if it helps any but I also have Geneious 9 and installed the BBMap plugin...maybe I could run part of the workflow in Geneious 9, then do the rest by running scripts. Anyhow I'll wait to hear back from Brian. Thanks!!

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM
                                • SEQadmin2
                                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                  by SEQadmin2



                                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                  07-08-2026, 05:17 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, 07-24-2026, 12:17 PM
                                0 responses
                                31 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-23-2026, 11:41 AM
                                0 responses
                                23 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-20-2026, 11:10 AM
                                0 responses
                                214 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-13-2026, 10:26 AM
                                0 responses
                                79 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...