splicing stats from Tophat's SAM output
Hi,
I just want tocheck thifat this is the right way to do it.
problem:
Using Tophat output (accepted_hits.sam) calculate statistics about spliced vs non_spliced hits.
Spliced reads looks like this:
8_105_178_344 0 scaffold09041 94954 255 9M7543N41M * 0 0 CAGTTAATTTCTGCGAACCGAAGATAACAACAGTGATAAGGGTCGCTACTAA BABBBBBBABA@BBBBBB@<B@@4>@A@0<0:?37<=999.<9=4<?7%2 NM:i:0 XS:A:- NS:i:0
solution:
grab CIGAR string "9M7543N41M", anything with number before N larger than minimal intron size (50 by default) should be a spliced read.
Is this correct?
Darek Kedra
I just want tocheck thifat this is the right way to do it.
problem:
Using Tophat output (accepted_hits.sam) calculate statistics about spliced vs non_spliced hits.
Spliced reads looks like this:
8_105_178_344 0 scaffold09041 94954 255 9M7543N41M * 0 0 CAGTTAATTTCTGCGAACCGAAGATAACAACAGTGATAAGGGTCGCTACTAA BABBBBBBABA@BBBBBB@<B@@4>@A@0<0:?37<=999.<9=4<?7%2 NM:i:0 XS:A:- NS:i:0
solution:
grab CIGAR string "9M7543N41M", anything with number before N larger than minimal intron size (50 by default) should be a spliced read.
Is this correct?
Darek Kedra
