Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • miRBase - Why do they not keep name conventions?

    Hi,

    according to the name conventions in miRBase, closely realted-but not similar- mature miRNAs should be named like miR-121a and miR-121b.

    " Lettered suffixes denote closely related mature sequences "

    Why does this not hold true for plant miRNAs?
    I work with medicago and for medicago there are a bunch of mature miRNAs with the same sequence.. For example:

    >mtr-miR2593a MIMAT0013280 Medicago truncatula miR2593a
    TTAAATGAATGAACCTAGAAT
    >mtr-miR2593b MIMAT0013281 Medicago truncatula miR2593b
    TTAAATGAATGAACCTAGAAT
    >mtr-miR2593c MIMAT0013282 Medicago truncatula miR2593c
    TTAAATGAATGAACCTAGAAT

    They have different PRECURSOR sequences but the mature sequence is completely the same. Does this make any sense at all? If you perform an experiment like sRNA-Seq you will only see the mature form and wont be able to identify the precurosr it was derived from anyway.

    Do you have any idea why people from miRBase do not stick to their own rules here?

    Cheers

Latest Articles

Collapse

  • seqadmin
    The Impact of AI in Genomic Medicine
    by seqadmin



    Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
    02-26-2024, 02:07 PM
  • seqadmin
    Multiomics Techniques Advancing Disease Research
    by seqadmin


    New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

    A major leap in the field has
    ...
    02-08-2024, 06:33 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 02-28-2024, 06:12 AM
0 responses
27 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-23-2024, 04:11 PM
0 responses
74 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-21-2024, 08:52 AM
0 responses
82 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-20-2024, 08:57 AM
0 responses
69 views
0 likes
Last Post seqadmin  
Working...
X