Originally posted by sam.a
View Post
Unconfigured Ad
Collapse
X
-
It is better sorted and then let Pindel directly read your sorted bam, -i config file.Originally posted by ralonso View PostI don't have it sorted, could I use it even this fact? or is it totally necessary to sort it?
Otherwise, you may use sam2pindel to extract reads (then use -p extracted_reads), but it is not recommended, as this takes additional space and runtime.
Kai
Leave a comment:
-
sorted sample.bam will be fine. Pindel reads bam files directly and get useful reads by itself.Originally posted by ralonso View PostHello,
I am about to use pindel and I am wondering some questions.
I have a file mapped with bwa and illumnia reads.
As I see in the pindel webpage https://trac.nbic.nl/pindel/wiki/UserManual I should use "unmappable read". I have several bams, so I don't know which to use, those are:
1. sample.bam: mapped and unmmapped reads,it is not sorted
2. sample_mapped.bam: just mapped reads, it is not sorted, it has not unmapped
3. sample_mapped_singlehit_sorted.bam: just mapped reads, it is sorted, it has only single hit and it is not unmapped
should I use one of this files? or maybe another with the unmappable reads?
thank you very much!
You need to use config file to tell Pindel where are your files, insert size and sample names.
Kai
Leave a comment:
-
Hello,
I am about to use pindel and I am wondering some questions.
I have a file mapped with bwa and illumnia reads.
As I see in the pindel webpage https://trac.nbic.nl/pindel/wiki/UserManual I should use "unmappable read". I have several bams, so I don't know which to use, those are:
1. sample.bam: mapped and unmmapped reads,it is not sorted
2. sample_mapped.bam: just mapped reads, it is not sorted, it has not unmapped
3. sample_mapped_singlehit_sorted.bam: just mapped reads, it is sorted, it has only single hit and it is not unmapped
should I use one of this files? or maybe another with the unmappable reads?
thank you very much!
Leave a comment:
-
Please check whether you switch on long insertion option. In some versions, this function is turned off by default.Originally posted by libiyagirl View PostHey Kai,
I am just wondering about the power of Pindel to detect long insertions. When I was running Pindel on a single chromosome, I didn't find any large insertions. But actually there are some duplications in that chromosome identified by breakdancer. Did I miss something? The "zero" LI looks very strange to me.
thanks a lot,
Kai
Leave a comment:
-
Hey Kai,
I am just wondering about the power of Pindel to detect long insertions. When I was running Pindel on a single chromosome, I didn't find any large insertions. But actually there are some duplications in that chromosome identified by breakdancer. Did I miss something? The "zero" LI looks very strange to me.
thanks a lot,
Leave a comment:
-
Default parameters of BWA is fine.Originally posted by fyusufi View PostHi Kai,
I was wondering if there were any special parameters required while running BWA, or are the default values ok?
Also, if I have sequence libraries with different insert sizes should I map them into separate bam files?
Thanks!
If you have multiple insert sizes, it is better to map them separately. It is possible to put them in one BAM if the insert sizes don't differ very much, say 400 vs 500. Pindel will internally double the number so that slightly underestimation is fine.
Kai
Leave a comment:
-
Hi Kai,
I was wondering if there were any special parameters required while running BWA, or are the default values ok?
Also, if I have sequence libraries with different insert sizes should I map them into separate bam files?
Thanks!
Leave a comment:
-
1. Can you indicate which linux distribution you are using? I would install it on my PC to test it.Originally posted by mig174 View PostI ran into some problems while trying to use pindel:
1. is there a 32bit-version?
2. while trying to compile version 0.2.4 there was an error with TIME_MINE_E, which is only set once to time(null) and never used in the rest of the code; as i did not see a possibility to fix that without writing around in your code, i decided to download version 0.2.0
3. after downloading version 0.2.0 and trying to run it with the parameters described on https://trac.nbic.nl/pindel/wiki/UserManual i only got the following usage information:
so it seems as if the information on the homepage is no longer accurate
finally i got it to run and it seems to work perfectly (thanks for that :-) ) but the way of getting there was a little painful.
2. There are many nice features and improvement in new version. It is strongly advised to use the new version. And current stable version is 0.2.4h. I would like to you help you compiling the latest version. Please communicate with me by email, [email protected]
3. Current user manual is for the versions after 0.2.3, which has different but a more user friendly interface.
4. We support both BWA and mosaik BAMs now.
Please contact me by email ([email protected]) or phone (+31 71 526 9745). We will find a solution for you to run the latest version of Pindel.
Cheers,
Kai
Leave a comment:
-
I ran into some problems while trying to use pindel:
1. is there a 32bit-version?
2. while trying to compile version 0.2.4 there was an error with TIME_MINE_E, which is only set once to time(null) and never used in the rest of the code; as i did not see a possibility to fix that without writing around in your code, i decided to download version 0.2.0
3. after downloading version 0.2.0 and trying to run it with the parameters described on https://trac.nbic.nl/pindel/wiki/UserManual i only got the following usage information:
so it seems as if the information on the homepage is no longer accurateWelcome to Pindel, developed by Kai Ye, [email protected]
7 parameters are required here:
1. Input: the reference genome sequences in fasta format;
2. Input: the unmapped reads in a modified fastq format;
Better to use bam2pindel.pl to convert BAM files to Pindel input.
If the perl script fails for some reasons, please use the provided
sam2pindel.cpp to extract reads from sam files.
Compile cpp file first: g++ sam2pindel.cpp -o sam2pindel -O3
3. Output folder
4. BreakDancer result:
ChrA LocA stringA ChrB LocB stringB others
If you don't have BreakDancer result, please provide an empty file here.
5. Maximum event size index. 5 is recommended
2: 128
3: 512
4: 2,048
5: 8,092
6: 32,368
7: 129,472
8: 517,888
9: 2,071,552
10: 8,286,208
11: 33,144,832
12: 132,579,328
6. Number of threads
7. Which chr/fragment
Pindel will process reads for one chr each time
ChrName must be the same as in reference sequence and in read file
finally i got it to run and it seems to work perfectly (thanks for that :-) ) but the way of getting there was a little painful.
Leave a comment:
-
-
I will be more explicit.
Hi Kai,
Here is one SV from the new version of pindel output. Could you explain how we get the number of normal reads versus the SV reads? Also, the header now is different with the new version for each SV, and for some reason, it is not coming to me what it all means. I must admit, I need to be become more educated with SVs.
####################################################################################################
4 D 1 NT 0 "" ChrID 20 BP 34005 34007 BP_range 34005 34023 Supports 11 11 + 2 2 - 9
9 S1 30 SUM_MS 660 2 NumSupSamples 2 2 COLO-829 2 2 5 5 COLO-829-BL 0 0 4 4
CAACCAGATATGCCTCCTTACAAGAGATTCTTAAGGGAGCTCTAAACCTACAATCAAAAGAACAACACCTGCTACaAAAAAAAAAAAAAAAACATACTTATGCACATAAAGACACTATAAAGCAACTACACTATCAAGTCTACATAATAA
CTTAAGGGAGCTCTAAACCTACAATCAAAAGAACAACACCTGCTAC AAAAAAAAAAAAAAAACATACTTATGCAC - 34175 60 COLO-829 @@EAS188_62:6:20:111:1106/2
CAAAAAAACAACACCTGCTAC AAAAAAAAAAAAAAAACATACTTATGCACATAAAGACACTATAAAGCAACTACA + 33660 60 COLO-829 @@EAS188_62:3:40:104:1946/1
CTAAACCTACAATCAAAAGAACAACACCTGCTAC AAAAAAAAAAAAAAAACATACTTTTGCACATAAAGACACTA - 34184 60 COLO-829 @@EAS139_60:7:37:896:889/2
AACAACACCTGCTAC AAAAAAAAAAAAAAAACATACTTATGCAAAAAAAAACACTATAAAGCAACTACACTATCA - 34396 60 COLO-829 @@EAS139_60:5:24:381:681/1
AAACCTACAATCAAAAGAACAACACCTGCTAC AAAAAAAAAAAAAAAACAAACTTATGCACATAAAGACACTATA - 34196 60 COLO-829 @@EAS131_8:8:43:784:1438/2
TAAACCTACAATCAAAAGAACAACACCTGCTAC AAAAAAAAAAAAAAAACATACTTATGCACATAAAGACACTAT - 34388 60 COLO-829 @@EAS131_6:8:39:243:1719/1
CTCTAAACCTACAATCAAAAGAACAACACCTGCTAC AAAAAAAAAAAAAAAACATACTTATGCACATAAAGACAC + 33667 60 COLO-829 @@EAS25_5:1:80:1493:28/1
TCAAAAGAACAACACCTGCTAC AAAAAAAAAAAAAAAACATACTTATGCACATAAAGACACTATAAAGCAACTAC - 34198 60 COLO-829-BL @@USI-EAS39_8289_FC30GCV_PE:5:18:1550:123/1
CTTAAGGGAGCTCTAAACCTACAATCAAAAGAACAACACCTGCTAC AAAAAAAAAAAAAAAACATACTTATGCAC - 34175 60 COLO-829-BL @@HWI-EAS300_8282_FC30BVC_PE:1:15:777:1187/1
TAAGGGAGCTCTAAACCTACAATCAAAAGAACAACACCTGCTAC AAAAAAAAAAAAAAAACATACTTATGCACAT - 34164 60 COLO-829-BL @@HWI-EAS255_8291_FC30GRN_PE:2:73:533:1356/2
GAGCTCTAAACCTACAATCAAAAGAACAACACCTGCTAC AAAAAAAAAAAAAAAACATACTTATGCACATAAAGA - 34192 60 COLO-829-BL @@HWI-EAS138_4_FC30GP8:4:54:1227:1320/2
Thanks for all of your assistance,
Dex
Leave a comment:
Latest Articles
Collapse
-
by SEQadmin2
CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).
Despite this, “CRISPR helped turn genome editing from a specialized technique into...-
Channel: Articles
07-31-2026, 11:01 AM -
-
by SEQadmin2
Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.
The systematic characterization of the human proteome has...-
Channel: Articles
07-20-2026, 11:48 AM -
-
by SEQadmin2
Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
...-
Channel: Articles
07-09-2026, 11:10 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, Today, 07:41 AM
|
0 responses
9 views
0 reactions
|
Last Post
by SEQadmin2
Today, 07:41 AM
|
||
|
Started by SEQadmin2, 08-03-2026, 10:13 AM
|
0 responses
21 views
0 reactions
|
Last Post
by SEQadmin2
08-03-2026, 10:13 AM
|
||
|
Started by SEQadmin2, 07-31-2026, 02:55 AM
|
0 responses
36 views
0 reactions
|
Last Post
by SEQadmin2
07-31-2026, 02:55 AM
|
||
|
Started by SEQadmin2, 07-24-2026, 12:17 PM
|
0 responses
25 views
0 reactions
|
Last Post
by SEQadmin2
07-24-2026, 12:17 PM
|
Leave a comment: