[DexterDuncan]

new pindel output format

Hi Kai,

Would you briefly explain the new pindel out put for version 0.2.3 below?

Thanks,

Dex

####################################################################################################
0 D 2 NT 0 "" ChrID 20 BP 74310 74313 BP_range 74310 74316 Supports 19 18 + 9 8
- 10 10 S1 110 SUM_MS 1016 1 NumSupSamples 1 1 blood 9 8 10 10

[KaiYe]

Hi Kai,

Thanks again to you and Eric_Wubbo for the new pindel and pindel2vcf. Is it still a good idea to use the filter of the bam2pinel.pl result files before using the new pindel?

Thanks,

Dex

If you use BAM files as input, you certainly don't have to use any filtering. If bam2pindel.pl is used first to extract reads, you can directly use it as input.

So you don't need to use filtering.

Kai

[DexterDuncan]

pindel_filter

Hi Kai,

Thanks again to you and Eric_Wubbo for the new pindel and pindel2vcf. Is it still a good idea to use the filter of the bam2pinel.pl result files before using the new pindel?

Thanks,

Dex

[KaiYe]

I finally managed it to work. After following your instructions I had to change also my input files (those generated by bam2pindel) because when comparing them with the demodata, mines had only one "@" in each line instead of 2 which had the demodata. I don´t know why did that happen because I obtained those input files with bam2pindel but anyway now it worked

Thanks a lot

one @ is enough.

[icg]

Hi Kai,

Thank you for the quick reply!

Here's the first 20 lines of my sam file.

Many thanks,
Inbar

@HD VN:1.0 SO:unsorted
@PG ID:novoalign VN:V2.07.05 CL:novoalign -d NC_007530.fna.nix -f output4.fastq -r ALL -o SAM
@SQ SN:gi|50196905|ref|NC_007530.2| AS:NC_007530.fna.nix LN:5227419
@SQ SN:gi|47566322|ref|NC_007322.2| AS:NC_007530.fna.nix LN:181677
@SQ SN:gi|50163691|ref|NC_007323.3| AS:NC_007530.fna.nix LN:94830
4:1:1169:930:Y 4 * 0 0 * * 0 0 NAAACAGTGAAGTATATAACGTACATGTCNAANNNNNNNNNNNNNNGNNNNNNNNNANNNNNNNNNNNNNNNNN #+,)-23444@@8@@@@@@@C@@@C################################################# PG:Z:novoalign ZS:Z:NM
4:1:1205:937:Y 0 gi|50196905|ref|NC_007530.2| 3730834 150 1S73M * 0 0 NAAAGAAGAATTACATCGCCATCTGTAGAATGAGCATAAGCTTTCACTACCGCTTCATCTAAAGTATCGACACT #(()'3..22@@@@@@@@7@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@ PG:Z:novoalign AS:i:10 UQ:i:10 NM:i:0 MD:Z:73
4:1:1231:930:Y 16 gi|50196905|ref|NC_007530.2| 899640 150 73M1S * 0 0 GAAAAGACCGAATTATCAGAATGTGTCGAATCTTCTTTTGAGAAAGTTCTTGATAACGAATGGTTTTGTATAGN 22CC@@@@@@C@@C@@@@C@C@CCC@@@@@@222@@@@@CC@@@C@C@@C@@CCC@@@@@CC2257777+000# PG:Z:novoalign AS:i:6 UQ:i:6 NM:i:0 MD:Z:73
4:1:1259:938:Y 4 * 0 0 * * 0 0 NAGCAAGGCAATGTAAAAGGCGAAAGACAAACAGCGGAAAGAGAAATTGAAATACAAAATAAATTAAGAAATAC ########################################################################## PG:Z:novoalign ZS:Z:QC
4:1:1290:941:Y 0 gi|47566322|ref|NC_007322.2| 169212 150 1S73M * 0 0 NGAAAATGCTCTTCAACTATTTGTATAGTCTATGTCACTCTTTTTTGGACTTTCCATATTGGGAGGGATGATTA #(*()00322@@@@C@C@@C@C@C@C@@@C@@@C@@@@@@@@@2222@@@C@C@@@@@C@@@@:@222:<@@@@ PG:Z:novoalign AS:i:10 UQ:i:10 NM:i:0 MD:Z:73
4:1:1307:933:Y 0 gi|50196905|ref|NC_007530.2| 4528377 150 1S73M * 0 0 NACGTAGTGGAATAGTTGAAAATTTAGATGAAGCTGATCCAGAAATTATTTTCTACACAAAAAAGCTCAGAGCA #(.((*,*))77755/0/00@@@@@@@@@@@@@:@@@@@@57055@@@@@22222@@@@@@2222@@@@@@7@@ PG:Z:novoalign AS:i:13 UQ:i:13 NM:i:0 MD:Z:73
4:1:1349:932:Y 0 gi|50196905|ref|NC_007530.2| 5190228 150 1S73M * 0 0 NGAACTATTTGAAAGATTATCTACGACTATAATTTTATAATTATTATTTAATAATTCTACACATGTATGACTAC #)*,.3103.@@@7@3<<<:@@@@@@@@@@@@@@@@@22@@@@@@@@@22@@@@@@@@@@<<<:::::::@@@@ PG:Z:novoalign AS:i:8 UQ:i:8 NM:i:0 MD:Z:73
4:1:1427:930:Y 4 * 0 0 * * 0 0 NATGTATTTGAATTATAACGTGATTCAATTTGGTTCTGGCGCAAGGAACCCAAGGGAGTTATAACTAACTCCCT ########################################################################## PG:Z:novoalign ZS:Z:QC
4:1:1455:932:Y 16 gi|50196905|ref|NC_007530.2| 4436146 150 73M1S * 0 0 CAAGACCTCCGGAATATGCTAATACAACTTTTTTCTTCTCCATTTTGCATCCCCCTAAAGAATAAATATTCATN @C@@@@C@CC@CC@@C@C@@@@@@@@@22222@@@@@@@@CC@@@CC@@@CCC@@22CC22C@C55566*(,,# PG:Z:novoalign AS:i:8 UQ:i:8 NM:i:0 MD:Z:73
4:1:1503:932:Y 0 gi|50196905|ref|NC_007530.2| 5174187 150 1S73M * 0 0 NAGAAGGAGAAACTTCAAATACAGTGAAACACCGCGATGGCCGTGTTTATGCGGAAGTAAGTGCAAAACTAACA #(*)&)*)*+<77<:58777:::::<:<<:8888885888:<:<:<<3<<:::1:@@@@@@@@@@@@@@@::<< PG:Z:novoalign AS:i:15 UQ:i:15 NM:i:0 MD:Z:73
4:1:1513:948:Y 16 gi|50196905|ref|NC_007530.2| 2854792 150 73M1S * 0 0 TGTAGAAAGTGAAAGTAAAAAAGATTCCAAAGACGCTCGTCCTTTTTCTCTATGAAATTCTTCTGCAAAATAAN C@C@C@CC@@@@@@@2222@C@@CC@@@C@C@@C@C@C@@@222C@@@C@@CCC@CCC@@@@@C71115-///# PG:Z:novoalign AS:i:6 UQ:i:6 NM:i:0 MD:Z:73
4:1:1536:944:Y 16 gi|50163691|ref|NC_007323.3| 77515 150 73M1S * 0 0 TTGCTTCAAGAAGGCGAAGAACAAATTTCTCTTTTCGATAATGTCACGCAACGAGAACAAGAAGTAAAGCTTAN @CC@@@@C@@CCC@@@C@22C@@@@@@@22@@C@@C@CC@@@@@@@@@@C@C@CC@@@@C@@C@58454,0*,# PG:Z:novoalign AS:i:7 UQ:i:7 NM:i:0 MD:Z:73
4:1:1696:942:Y 4 * 0 0 * * 0 0 NCTTATCTGCAATTGAAGGAATTAAAGTAGACAAACATTCAACTGGTGGTGTTGGTGATACAACAACATTAGTA ########################################################################## PG:Z:novoalign ZS:Z:QC
4:1:1724:952:Y 0 gi|50196905|ref|NC_007530.2| 641128 150 1S73M * 0 0 NAGATCTATTTTCGATAAAAATAACGAATGAAATTCCTACAATTGTGATGGACCAGAGAACGCCGACAAATGTA #+++-32223C22CC@@CC222222@@@@0:::::CC@@@CC@C@@@C@@CC@@CCC@CC@C@C@C@@@@@@@@ PG:Z:novoalign AS:i:6 UQ:i:6 NM:i:0 MD:Z:73
4:1:1766:932:Y 4 * 0 0 * * 0 0 NCATTAAGAAGTTTCATCATGTCCGCTGTAAACTGTTGTTCTAGTTCGTTACTTAAGACGCTTCCCTTTGAAAG ########################################################################## PG:Z:novoalign ZS:Z:QC

[chariko]

hi,

You should use -p for extracted reads. -i is for configuration file.

Pindel accepts two types of input:
1. extracted reads with sam2pindel or bam2pindel, using -p
2. a configure file for a list of BAMs, using -i
the format of the configure file
/path/to/bam_1/BAM_1 400 sample_1
/path/to/bam_2/BAM_2 400 sample_2
...
/path/to/bam_n/BAM_n 400 sample_n

you may also use -c chrN:start-end to specify a small region of the region to parallelize the computation.

Kai

I finally managed it to work. After following your instructions I had to change also my input files (those generated by bam2pindel) because when comparing them with the demodata, mines had only one "@" in each line instead of 2 which had the demodata. I don´t know why did that happen because I obtained those input files with bam2pindel but anyway now it worked

Thanks a lot

[KaiYe]

Hi KaiYe,

I'm trying to convert my BAM file (illumina single-end reads, aligned using Novoalign) to the pindel format, using sam2pindel but the output file is empty.

I used the following command:
./sam2pindel novo.sam Output4Pindel.txt 300 test 0

What am I doing wrong?


Thanks in advance for your reply,

Inbar

hi Inbar,

sam2pindel requires the mate information stored in each record. I guess novoalign doesn't report that.

can you provide a few lines of sam records?

Kai

[icg]

sam2pindel

Would you please inform me your email address? I have cpp code to extract reads from sam files for Pindel.

Thanks.

Hi KaiYe,

I'm trying to convert my BAM file (illumina single-end reads, aligned using Novoalign) to the pindel format, using sam2pindel but the output file is empty.

I used the following command:
./sam2pindel novo.sam Output4Pindel.txt 300 test 0

What am I doing wrong?


Thanks in advance for your reply,

Inbar

[KaiYe]

Hi KaiYe,

I am having the same problem as jtjli (http://seqanswers.com/forums/showthr...0820#post30820). I did as follows:

1) Download all files from http://www.ebi.ac.uk/~kye/pindel/v_0.2.0/. I aligned with BWA, processed with samtools and filtered by MAPQ quality (<30).
2) ran bam2pindel.pl on one paired-end samples (aligned using BWA). My bam file is sorted and duplicates are removed but it does not have the header expected by your program, so i used the -om to force the script to run. A file for each chromosome was generated: e.g. myprefix.1.txt (chr1)
3) I downloaded your source code from sourceforge (with svn) and compiled your pindel from scratch. It seems to work.
4) I run the following comand
/home/Pindel_source_v0.2.2/pindel -f /home/hg19.fa -i /s_4_QC_sort_pind.bam_chr1.txt -o ./s4 -c chr1 empty

but whichever chromosome i try, i always get "There are no reads for this chromosome":

BreakDancer events: 0
Processing chromosome: chr10
Skipping chromosome: chr10
...

Processing chromosome: chr1
Chromosome Size: 249250621
26926 10000
Looking at chromosome chr1 bases 0 to 10000000.
BinBorder 0 10000000
There are no reads for this bin.
Looking at chromosome chr1 bases 10000000 to 20000000.
BinBorder 10000000 20000000
There are no reads for this bin.
....
Loading genome sequences and reads: 0 seconds.
Mining, Sorting and output results: 0 seconds.

What I am doing wrong? How did you solve jtjli's problem?

hi,

You should use -p for extracted reads. -i is for configuration file.

Pindel accepts two types of input:
1. extracted reads with sam2pindel or bam2pindel, using -p
2. a configure file for a list of BAMs, using -i
the format of the configure file
/path/to/bam_1/BAM_1 400 sample_1
/path/to/bam_2/BAM_2 400 sample_2
...
/path/to/bam_n/BAM_n 400 sample_n

you may also use -c chrN:start-end to specify a small region of the region to parallelize the computation.

Kai

[chariko]

I will send you my source code via email.

Hi KaiYe,

I am having the same problem as jtjli (http://seqanswers.com/forums/showthr...0820#post30820). I did as follows:

1) Download all files from http://www.ebi.ac.uk/~kye/pindel/v_0.2.0/. I aligned with BWA, processed with samtools and filtered by MAPQ quality (<30).
2) ran bam2pindel.pl on one paired-end samples (aligned using BWA). My bam file is sorted and duplicates are removed but it does not have the header expected by your program, so i used the -om to force the script to run. A file for each chromosome was generated: e.g. myprefix.1.txt (chr1)
3) I downloaded your source code from sourceforge (with svn) and compiled your pindel from scratch. It seems to work.
4) I run the following comand
/home/Pindel_source_v0.2.2/pindel -f /home/hg19.fa -i /s_4_QC_sort_pind.bam_chr1.txt -o ./s4 -c chr1 empty

but whichever chromosome i try, i always get "There are no reads for this chromosome":

BreakDancer events: 0
Processing chromosome: chr10
Skipping chromosome: chr10
...

Processing chromosome: chr1
Chromosome Size: 249250621
26926 10000
Looking at chromosome chr1 bases 0 to 10000000.
BinBorder 0 10000000
There are no reads for this bin.
Looking at chromosome chr1 bases 10000000 to 20000000.
BinBorder 10000000 20000000
There are no reads for this bin.
....
Loading genome sequences and reads: 0 seconds.
Mining, Sorting and output results: 0 seconds.

What I am doing wrong? How did you solve jtjli's problem?

[Fabrice ODEFREY]

alright, that's what I thought, thanks!
Fabrice

[KaiYe]

thanks a lot Kai for your quick reply.
for the second step is there a tool to do that?
thanks again!
Fabrice

The second step is rather straight forward but requires knowledge on your SOLiD data about the strand. I know that some SOLiD data satisfies the second requirement without any modification but the others need additional a converting step.

You may need to write a script to do that.

Kai

[Fabrice ODEFREY]

thanks a lot Kai for your quick reply.
for the second step is there a tool to do that?
thanks again!
Fabrice

[KaiYe]

Hi KaiYe,

I'm working with SOLiD data...and would like to use Pindel but couldn't find anything about it. is Pindel only for Illumina data?
thanks in advance for your reply.
Fabrice

hi Fabrice,

I don't have a procedure with SOLiD data but would explore this together with you.

First you need to convert the data from color space to sequence space.

Second, convert the sequence to the correct strand. Pindel assume the data is paired-end as illumina so that the reads are facing each other rather than on the same strand.

You may then try my sam2pindel.cpp to extract reads and run Pindel.

Please visit https://trac.nbic.nl/pindel and register as a Pindel user.

Kai

[Fabrice ODEFREY]

Hi KaiYe,

I'm working with SOLiD data...and would like to use Pindel but couldn't find anything about it. is Pindel only for Illumina data?
thanks in advance for your reply.
Fabrice