Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • deuterium
    Junior Member
    • Mar 2012
    • 8

    #1

    problem of mapping SOLiD data using tophat2

    When I using tophat to map SOLiD data (dataset: DRR013130) with the following parameters (tophat2 -m 2 -p 8 --color --quals --bowtie1 -G /home/mm10/mm10_GTF/genes.gtf -o /media/DRR013130_Oo_3_F3 /home/mm10/BowtieCIndex/genome /media/DRR013130_Oo_3_F3.csfasta /media/DRR013130_Oo_3_F3_QV.qual), I found out that each length of the quality of sequence in unmapped.fastq (which is converted from unmapped.bam using bam2fastx) is 1 length shorter than itself length. However, this problem does happen in accepted_hits.fastq (converted from accepted_hits.bam). How could it happen and how to solve it?
    Thank you very much for your help!

    -----------------------------------------------------------------------------------
    >head unmapped.fastq
    @DRR013130_Oo_3.3872899
    TTGACCTTACGCTCGTGTCAATTGAACTCTTATGCTACCCCTACCGTCAGA 51 length
    +
    @==;@==?>@?@@@@?@@@@@?;@@2@:/66226?6/8/6?8;/=;;>8/ 50 length
    @DRR013130_Oo_3.12296928
    TGACCGTCTTAGACATATCTCCGTCGTAGGGATCCCCGGCTAACGGATCCG 51 length
    +
    @@@@@@@@@@@@@@@@@@@@@@@?@@@;=@@@?6?@@6//2//66//26/ 50 length
    -----------------------------------------------------------------------------------
    >head accepted_hits.fastq
    @DRR013130_Oo_3.9803742
    ACTTTTACAAGGCCTAATGGTGACTCCTACAGTGGTTGACACCGACTACC 50 length
    +
    @__]L@Q__UU]]___[[____]]^^___WW____UU__22___[QS]W8 50 length
    @DRR013130_Oo_3.15175672
    CAACCTAAAATAAAAACAACTAAAAAAGCTGACTCGTGAGGCAAAAAGAC 50 length
    +
    @________^^___________]]__________________]]__[[_@ 50 length
    Last edited by deuterium; 09-24-2014, 10:41 AM.
  • deuterium
    Junior Member
    • Mar 2012
    • 8

    #2
    I think I should remove the "T" at the head of each sequence in unmapping.fastq, could anyone help me to write a script to do that?
    Thanks very much!

    Comment

    • WhatsOEver
      Senior Member
      • Apr 2012
      • 215

      #3
      If the length of the sequence and corresponding quality scores is not equal, you have an error in your input data! (I'm actually a little surprised that tophat is not complaining about these entries) How do you know that the quality score from the leading "T" is missing and not from any other base? Maybe quality score conversion failed totally for these reads (for what ever reason - you have to look into the raw data to check this).

      Comment

      • Brian Bushnell
        Super Moderator
        • Jan 2014
        • 2709

        #4
        Solid data has 1 more "bases" than qualities, because it starts with one fixed base (in this case T) followed by numbers (0-3). But what you are showing is not Solid data. You need to go back to the original colorspace data and map it in colorspace; Solid data cannot be accurately converted to bases without mapping first.

        Comment

        • WhatsOEver
          Senior Member
          • Apr 2012
          • 215

          #5
          But the data was mapped in colorspace.
          Originally posted by deuterium
          (tophat2 -m 2 -p 8 --color --quals --bowtie1 -G /home/mm10/mm10_GTF/genes.gtf -o /media/DRR013130_Oo_3_F3 /home/mm10/BowtieCIndex/genome /media/DRR013130_Oo_3_F3.csfasta /media/DRR013130_Oo_3_F3_QV.qual
          I didn't know that you cannot convert at all without mapping. I would be interested to know how tophat/bowtie is converting the unmappable reads in this case?! If it is really just an additional T at the start you could simply use sed to remove it:

          Code:
           sed 's/^T//g' ./yourFastqFile.fastq
          This will delete 1 leading "T" at the beginning of each line (your quality lines should not have a "T" in them, so there is no need to handle that)

          Comment

          • dpryan
            Devon Ryan
            • Jul 2011
            • 3478

            #6
            @WhatsoEver: It's a really bad idea to handle colorspace data in basespace.

            Comment

            • WhatsOEver
              Senior Member
              • Apr 2012
              • 215

              #7
              It wasn't my idea, just the answer to the authors question And to point that out: I didn't mean to remove the leading "T" in the ".csfasta" file, I meant to delete it in the "unmapped.fastq" file.

              Anyhow, the question would then be of what value is the data in unmapped.bam? If it cannot be used, why/how is it converted?

              Comment

              • deuterium
                Junior Member
                • Mar 2012
                • 8

                #8
                @WhatsOEver
                Thank you very much! This script is really helpful!

                Comment

                • deuterium
                  Junior Member
                  • Mar 2012
                  • 8

                  #9
                  Originally posted by WhatsOEver View Post
                  It wasn't my idea, just the answer to the authors question And to point that out: I didn't mean to remove the leading "T" in the ".csfasta" file, I meant to delete it in the "unmapped.fastq" file.

                  Anyhow, the question would then be of what value is the data in unmapped.bam? If it cannot be used, why/how is it converted?
                  Yes, I think it is a bug of tophat2!

                  Comment

                  Latest Articles

                  Collapse

                  • SEQadmin2
                    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                    by SEQadmin2



                    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                    Despite this, “CRISPR helped turn genome editing from a specialized technique into
                    ...
                    07-31-2026, 11:01 AM
                  • SEQadmin2
                    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                    by SEQadmin2


                    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                    The systematic characterization of the human proteome has
                    ...
                    07-20-2026, 11:48 AM

                  ad_right_rmr

                  Collapse

                  News

                  Collapse

                  Topics Statistics Last Post
                  Started by SEQadmin2, 08-13-2026, 12:22 PM
                  0 responses
                  20 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 08-11-2026, 10:35 AM
                  0 responses
                  17 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 08-06-2026, 07:41 AM
                  0 responses
                  32 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 08-03-2026, 10:13 AM
                  0 responses
                  50 views
                  0 reactions
                  Last Post SEQadmin2  
                  Working...