Header Leaderboard Ad

Collapse

adapter trimming miRNA sequencing

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • adapter trimming miRNA sequencing

    Below is the output from FastQC. Any idea what to trim for? Tried the Illumina Single End Adapter 1 but got no mapping. What are the A, and how do I get rid of them?


    ATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAA 4805262 44.91006094070466 Illumina Single End Adapter 1 (95% over 24bp)
    GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAAAA 1107781 10.353340196425243 No Hit
    GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAACA 200679 1.8755493705691118 No Hit
    CGATCATCTCGTATGCCGTCTTCTGCTTGAAAAAAA 144914 1.3543687256098158 Illumina PCR Primer Index 7 (96% over 29bp)
    TAGCTTATCAGACTGATGTTGACATCTCGTATGCCG 140931 1.3171435394021074 No Hit
    GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAACAA 124510 1.1636725921972906 No Hit
    TGTAAACATCCTTGACTGGAAGCATCTCGTATGCCG 114871 1.0735863331322382 No Hit
    TCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAA 112198 1.048604429357896 Illumina Single End Adapter 1 (100% over 21bp)
    TCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAA 110008 1.0281366518547872 Illumina Single End Adapter 1 (95% over 23bp)
    ATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAC 94442 0.8826565492915952 Illumina Single End Adapter 1 (95% over 24bp)
    GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAAAC 82271 0.7689061748667841 No Hit
    TGAGGTAGTAGGTTGTATAGTTATCTCGTATGCCGT 77257 0.7220452450035024 No Hit
    GTAGTGTTTCCTACTTTATGGAATCTCGTATGCCGT 62069 0.5800979369134498 No Hit
    GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAACAAA 58659 0.5482280185181984 No Hit

  • #2
    Hi Palgrave,
    Have you visited here -
    http://support.illumina.com/download...ce-letter.html
    The pdf file enlists all adapter sequences. If you copy the first entry in your list (without the polyA tail) and search in the pdf, you will see that its the TruSeq adapter.

    I wouldn't bother about the polyA and just give the remaining sequence as a contaminant to any adapter trimmer tool. When the tool chops, the polyA's get removed too. I use Trimmomatic (can use multiple threads).

    Comment


    • #3
      I've used trimmomatic with the adapters file that comes along with fastqc converted to a fasta file. Worked good. The As might be after it reads all the way through the adapter and isn't reading anything, maybe?

      Comment


      • #4
        try skewer

        Originally posted by Palgrave View Post
        Below is the output from FastQC. Any idea what to trim for? Tried the Illumina Single End Adapter 1 but got no mapping. What are the A, and how do I get rid of them?


        ATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAA 4805262 44.91006094070466 Illumina Single End Adapter 1 (95% over 24bp)
        GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAAAA 1107781 10.353340196425243 No Hit
        GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAACA 200679 1.8755493705691118 No Hit
        CGATCATCTCGTATGCCGTCTTCTGCTTGAAAAAAA 144914 1.3543687256098158 Illumina PCR Primer Index 7 (96% over 29bp)
        TAGCTTATCAGACTGATGTTGACATCTCGTATGCCG 140931 1.3171435394021074 No Hit
        GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAACAA 124510 1.1636725921972906 No Hit
        TGTAAACATCCTTGACTGGAAGCATCTCGTATGCCG 114871 1.0735863331322382 No Hit
        TCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAA 112198 1.048604429357896 Illumina Single End Adapter 1 (100% over 21bp)
        TCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAA 110008 1.0281366518547872 Illumina Single End Adapter 1 (95% over 23bp)
        ATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAC 94442 0.8826565492915952 Illumina Single End Adapter 1 (95% over 24bp)
        GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAAAC 82271 0.7689061748667841 No Hit
        TGAGGTAGTAGGTTGTATAGTTATCTCGTATGCCGT 77257 0.7220452450035024 No Hit
        GTAGTGTTTCCTACTTTATGGAATCTCGTATGCCGT 62069 0.5800979369134498 No Hit
        GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAACAAA 58659 0.5482280185181984 No Hit
        Hi Palgrave,

        From the pdf file provided by illimina, you will find ATCTCGTATGCCGTCTTCTGCTTG is actually the v1.5 Small RNA 3' Adapter. Never mind those tailing poly-A as they are fake base-calls by the illumina sequencer if there is no base detected. A mature adapter trimmer will trim those tailing poly-A next to adapter sequence.

        Though trimmomatic seems to be specifically optimized for small RNA adapter trimming, I also recommend you using the skewer (http://sourceforge.net/projects/skewer ) tool which is not optimized for any specific applications but performs equally well or even better for small RNA adapter trimming.

        For your case, the command is very simple like this:
        Code:
        skewer -x ATCTCGTATGCCGTCTTCTGCTTG -l 16 -L 30 yourData.fastq

        Comment

        Working...
        X