Seqanswers Leaderboard Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • arkilis
    Senior Member
    • Jul 2013
    • 119

    Any suggestion on how to get to know the seq data is from which platform?

    Got some data from other lab people. They are not sure what platform it is. So I used the fastqc which can have a check on the read length and some tips on what platform it is. i.e. Quality scores across all bases (Sanger/ illumina 1.9 encoding). I would reckon it is probably from sanger.

    Any other thoughts?

    Thanks,
  • Brian Bushnell
    Super Moderator
    • Jan 2014
    • 2709

    #2
    Posting read headers may help; someone may recognized them. Also, a read length histogram (or range) might help narrow it down.

    Comment

    • arkilis
      Senior Member
      • Jul 2013
      • 119

      #3
      Originally posted by Brian Bushnell View Post
      Posting read headers may help; someone may recognized them. Also, a read length histogram (or range) might help narrow it down.
      Thanks for answering.

      One example line here is :

      @M00474:102:000000000-A9000:1:1101:19225:1361 1:N:0:1
      TGCTCACCTCGCCGCTGCACTGTGAAGCTCTCACCAACCCCGTAGTTGTTTCTGCACACGGTGTCCACCTGGCCCCGCCTGTCCTCCAGGATGTCCTTCTGGCTGTTCCAGGACTCGGCGACAGGCCGCCCTAGCTCCGTCACCGCCCGGTACTCCCCCCCGTCGCTGTCGAAGCGCACGAACTCCTCCTGGTTATAGAAGAGTCTTTCCAGGAACTGCACCCGCTCCGTCCCGTTGAAGAAATGACACTT
      +
      CACCCGGGGGBFGCGGGGFGGFGGDEGGFGGGGGGECFGGGGGDCFGFF,CFGGGGGGGD@FCGGGFGGGC,EFGGGGGG@FGGGGGFFFFGGFGGGGGG9<FGCFGGGGGFGFGGECFFDFB:BFGEFGGGDCFFGG@EGGGGGGGGG7E@EFGFGGG*CEEG:CEEGGGF5EDDGDEEGDGGGFFFGGFCFFFFF6D*)9CFGFFGFGG9:?(8?FF7?FB>>9>BB??FFFBFF()6<2:AABA7?B9

      Any idea? Thanks again!

      Comment

      • Brian Bushnell
        Super Moderator
        • Jan 2014
        • 2709

        #4
        Given that it's 251bp long, and the name look like the MiSeq convention, I would say that it's an Illumina MiSeq read.

        Comment

        • arkilis
          Senior Member
          • Jul 2013
          • 119

          #5
          Originally posted by Brian Bushnell View Post
          Given that it's 251bp long, and the name look like the MiSeq convention, I would say that it's an Illumina MiSeq read.
          You are right. Mr. Genius! Just get confirmed with client. MiSeq.

          Comment

          Latest Articles

          Collapse

          • seqadmin
            New Genomics Tools and Methods Shared at AGBT 2025
            by seqadmin


            This year’s Advances in Genome Biology and Technology (AGBT) General Meeting commemorated the 25th anniversary of the event at its original venue on Marco Island, Florida. While this year’s event didn’t include high-profile musical performances, the industry announcements and cutting-edge research still drew the attention of leading scientists.

            The Headliner
            The biggest announcement was Roche stepping back into the sequencing platform market. In the years since...
            03-03-2025, 01:39 PM
          • seqadmin
            Investigating the Gut Microbiome Through Diet and Spatial Biology
            by seqadmin




            The human gut contains trillions of microorganisms that impact digestion, immune functions, and overall health1. Despite major breakthroughs, we’re only beginning to understand the full extent of the microbiome’s influence on health and disease. Advances in next-generation sequencing and spatial biology have opened new windows into this complex environment, yet many questions remain. This article highlights two recent studies exploring how diet influences microbial...
            02-24-2025, 06:31 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, 03-20-2025, 05:03 AM
          0 responses
          17 views
          0 reactions
          Last Post seqadmin  
          Started by seqadmin, 03-19-2025, 07:27 AM
          0 responses
          18 views
          0 reactions
          Last Post seqadmin  
          Started by seqadmin, 03-18-2025, 12:50 PM
          0 responses
          19 views
          0 reactions
          Last Post seqadmin  
          Started by seqadmin, 03-03-2025, 01:15 PM
          0 responses
          186 views
          0 reactions
          Last Post seqadmin  
          Working...