Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • arkilis
    replied
    Originally posted by Brian Bushnell View Post
    Given that it's 251bp long, and the name look like the MiSeq convention, I would say that it's an Illumina MiSeq read.
    You are right. Mr. Genius! Just get confirmed with client. MiSeq.

    Leave a comment:


  • Brian Bushnell
    replied
    Given that it's 251bp long, and the name look like the MiSeq convention, I would say that it's an Illumina MiSeq read.

    Leave a comment:


  • arkilis
    replied
    Originally posted by Brian Bushnell View Post
    Posting read headers may help; someone may recognized them. Also, a read length histogram (or range) might help narrow it down.
    Thanks for answering.

    One example line here is :

    @M00474:102:000000000-A9000:1:1101:19225:1361 1:N:0:1
    TGCTCACCTCGCCGCTGCACTGTGAAGCTCTCACCAACCCCGTAGTTGTTTCTGCACACGGTGTCCACCTGGCCCCGCCTGTCCTCCAGGATGTCCTTCTGGCTGTTCCAGGACTCGGCGACAGGCCGCCCTAGCTCCGTCACCGCCCGGTACTCCCCCCCGTCGCTGTCGAAGCGCACGAACTCCTCCTGGTTATAGAAGAGTCTTTCCAGGAACTGCACCCGCTCCGTCCCGTTGAAGAAATGACACTT
    +
    CACCCGGGGGBFGCGGGGFGGFGGDEGGFGGGGGGECFGGGGGDCFGFF,CFGGGGGGGD@FCGGGFGGGC,EFGGGGGG@FGGGGGFFFFGGFGGGGGG9<FGCFGGGGGFGFGGECFFDFB:BFGEFGGGDCFFGG@EGGGGGGGGG7E@EFGFGGG*CEEG:CEEGGGF5EDDGDEEGDGGGFFFGGFCFFFFF6D*)9CFGFFGFGG9:?(8?FF7?FB>>9>BB??FFFBFF()6<2:AABA7?B9

    Any idea? Thanks again!

    Leave a comment:


  • Brian Bushnell
    replied
    Posting read headers may help; someone may recognized them. Also, a read length histogram (or range) might help narrow it down.

    Leave a comment:


  • Any suggestion on how to get to know the seq data is from which platform?

    Got some data from other lab people. They are not sure what platform it is. So I used the fastqc which can have a check on the read length and some tips on what platform it is. i.e. Quality scores across all bases (Sanger/ illumina 1.9 encoding). I would reckon it is probably from sanger.

    Any other thoughts?

    Thanks,

Latest Articles

Collapse

  • seqadmin
    Current Approaches to Protein Sequencing
    by seqadmin


    Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
    04-04-2024, 04:25 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 04-11-2024, 12:08 PM
0 responses
34 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 10:19 PM
0 responses
37 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 09:21 AM
0 responses
33 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-04-2024, 09:00 AM
0 responses
54 views
0 likes
Last Post seqadmin  
Working...
X