Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Brian Bushnell
    replied
    Hi Jen,

    My tools are all still unpublished, so please just cite my name and website. Thanks!

    -Brian

    Leave a comment:


  • JenBarb
    replied
    Hi Brian,
    How should I cite your tool in a manuscript in prep that I am doing? Do you have a reference or should I use your website?
    Thanks,
    Jen

    Leave a comment:


  • Brian Bushnell
    replied
    If you have not solved this problem yet, there's another option, using BBTools:

    reformat.sh in=reads.fq out=trimmed.fq ftr=19

    This will trim all but the first 20 bases (all bases after position 19, zero-based).

    kmercountexact.sh in=trimmed.fq out=counts.txt fastadump=f mincount=10 k=20 rcomp=f
    This will generate a file containing the counts of all 20-mers that occurred at least 10 times, in a 2-column format that is easy to sort in Excel. For example:

    Code:
    ACCGTTACCGTTACCGTTAC	100
    AAATTTTTTTCCCCCCCCCC	85
    ...etc. If the primers are 20bp long, they should be pretty obvious.

    Leave a comment:


  • maubp
    replied
    e.g. FASTQC reports overrepresented sequences which ought to spot your primers:

    Leave a comment:


  • JenBarb
    replied
    maubp,
    I would love to find a tool that will spot and report possible primers. Can you be more specific?

    I tried to sort and tally up the sequences and i am not finding them this way. Which tool are you referring to?

    Thanks a bunch.
    Jen

    Leave a comment:


  • maubp
    replied
    IIRC, some FASTQ quality control pipelines will spot and report possible primer sequences.

    Leave a comment:


  • cmbetts
    replied
    Something like that should be pretty easy to do with any scripting language with fastq parsing libraries (or heck maybe manually inspecting the fastq since there's only 6 primers if you're not keen on programming).

    Example R psuedocode (only because that's what I'm comfortable with)
    library("ShortRead"); #load the library for fastq manipulation
    fq_data <- readFastq("reads.fastq.gz"); #read in fastq data
    base_info <- sread(fq_data); #get just the base calls
    first20 <- substring(base_info, 1, 20); #get the first 20bp of each read

    then you could do something like
    table(first20) to see the frequency of different 20bp sequences
    alphabetFrequency(first20) to get consensus sequences

    Leave a comment:


  • JenBarb
    started a topic Pull out unknown primers from fastq file?

    Pull out unknown primers from fastq file?

    Hello,
    I have fastq files from 16S sequencing data. The reads in these files have 6 different primers in them and I am wondering if anyone knows of a method where I can pull out the beginning of the reads, maybe 20-30 bps and then look for consensus sequences within these? This will then give me the primer sequence information for the 6 primers which is proprietary information from the company where the kits are made.

    Can anyone think of a way to do this?
    Thanks!

Latest Articles

Collapse

  • seqadmin
    Multiomics Techniques Advancing Disease Research
    by seqadmin


    New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

    A major leap in the field has
    ...
    02-08-2024, 06:33 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 02-21-2024, 08:52 AM
0 responses
30 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-20-2024, 08:57 AM
0 responses
20 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-14-2024, 09:19 AM
0 responses
55 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-12-2024, 03:37 PM
0 responses
461 views
0 likes
Last Post seqadmin  
Working...
X