Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Pull out unknown primers from fastq file?

    Hello,
    I have fastq files from 16S sequencing data. The reads in these files have 6 different primers in them and I am wondering if anyone knows of a method where I can pull out the beginning of the reads, maybe 20-30 bps and then look for consensus sequences within these? This will then give me the primer sequence information for the 6 primers which is proprietary information from the company where the kits are made.

    Can anyone think of a way to do this?
    Thanks!

  • #2
    Something like that should be pretty easy to do with any scripting language with fastq parsing libraries (or heck maybe manually inspecting the fastq since there's only 6 primers if you're not keen on programming).

    Example R psuedocode (only because that's what I'm comfortable with)
    library("ShortRead"); #load the library for fastq manipulation
    fq_data <- readFastq("reads.fastq.gz"); #read in fastq data
    base_info <- sread(fq_data); #get just the base calls
    first20 <- substring(base_info, 1, 20); #get the first 20bp of each read

    then you could do something like
    table(first20) to see the frequency of different 20bp sequences
    alphabetFrequency(first20) to get consensus sequences

    Comment


    • #3
      IIRC, some FASTQ quality control pipelines will spot and report possible primer sequences.

      Comment


      • #4
        maubp,
        I would love to find a tool that will spot and report possible primers. Can you be more specific?

        I tried to sort and tally up the sequences and i am not finding them this way. Which tool are you referring to?

        Thanks a bunch.
        Jen

        Comment


        • #5
          e.g. FASTQC reports overrepresented sequences which ought to spot your primers:

          Comment


          • #6
            If you have not solved this problem yet, there's another option, using BBTools:

            reformat.sh in=reads.fq out=trimmed.fq ftr=19

            This will trim all but the first 20 bases (all bases after position 19, zero-based).

            kmercountexact.sh in=trimmed.fq out=counts.txt fastadump=f mincount=10 k=20 rcomp=f
            This will generate a file containing the counts of all 20-mers that occurred at least 10 times, in a 2-column format that is easy to sort in Excel. For example:

            Code:
            ACCGTTACCGTTACCGTTAC	100
            AAATTTTTTTCCCCCCCCCC	85
            ...etc. If the primers are 20bp long, they should be pretty obvious.

            Comment


            • #7
              Hi Brian,
              How should I cite your tool in a manuscript in prep that I am doing? Do you have a reference or should I use your website?
              Thanks,
              Jen

              Comment


              • #8
                Hi Jen,

                My tools are all still unpublished, so please just cite my name and website. Thanks!

                -Brian

                Comment

                Latest Articles

                Collapse

                • seqadmin
                  Best Practices for Single-Cell Sequencing Analysis
                  by seqadmin



                  While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
                  06-06-2024, 07:15 AM
                • seqadmin
                  Latest Developments in Precision Medicine
                  by seqadmin



                  Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

                  Somatic Genomics
                  “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
                  05-24-2024, 01:16 PM

                ad_right_rmr

                Collapse

                News

                Collapse

                Topics Statistics Last Post
                Started by seqadmin, Yesterday, 07:24 AM
                0 responses
                10 views
                0 likes
                Last Post seqadmin  
                Started by seqadmin, 06-13-2024, 08:58 AM
                0 responses
                11 views
                0 likes
                Last Post seqadmin  
                Started by seqadmin, 06-12-2024, 02:20 PM
                0 responses
                16 views
                0 likes
                Last Post seqadmin  
                Started by seqadmin, 06-07-2024, 06:58 AM
                0 responses
                184 views
                0 likes
                Last Post seqadmin  
                Working...
                X