Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Truncated File: Trouble with SRA > Fastq > Sam

    Hi everyone,

    I know there have been several posts regarding truncated SAM files, but I'm having a difficult time finding a solution.

    I've converted an SRA file to FASTQ with fastq-dump:
    Code:
    fastq-dump [SRA] [Output-prefix]
    QC/Trimmed the FASTQ,

    Bowtie to align (SAM output):
    Code:
    bowtie -n 2 -k 1 -l 40 --best -m 1 -S [genome] [FASTQ] [SAM output]
    But when I try to convert sam to bam
    Code:
    $ samtools view -Sb [.SAM] > [.BAM]
    [W::sam_read1] parse error at line 26
    [main_samview] truncated file.
    So I looked at line 26 and it does appear odd (bottom line):
    Code:
    @HD	VN:1.0	SO:unsorted
    @SQ	SN:chr1	LN:197195432
    @SQ	SN:chr2	LN:181748087
    @SQ	SN:chr3	LN:159599783
    @SQ	SN:chr4	LN:155630120
    @SQ	SN:chr5	LN:152537259
    @SQ	SN:chr6	LN:149517037
    @SQ	SN:chr7	LN:152524553
    @SQ	SN:chr8	LN:131738871
    @SQ	SN:chr9	LN:124076172
    @SQ	SN:chr10	LN:129993255
    @SQ	SN:chr11	LN:121843856
    @SQ	SN:chr12	LN:121257530
    @SQ	SN:chr13	LN:120284312
    @SQ	SN:chr14	LN:125194864
    @SQ	SN:chr15	LN:103494974
    @SQ	SN:chr16	LN:98319150
    @SQ	SN:chr17	LN:95272651
    @SQ	SN:chr18	LN:90772031
    @SQ	SN:chr19	LN:61342430
    @SQ	SN:chrX	LN:166650296
    @SQ	SN:chrY	LN:15902555
    @SQ	SN:chrM	LN:16299
    @PG	ID:Bowtie	VN:1.1.1	CL:"bowtie --wrapper basic-0 -n 2 -k 1 -l 40 --best -m 1 -S /Users/DPC/Documents/Genome_Indexes/mm9.ebwt/mm9 /Volumes/My Passport/Hi-C/ChIP-seq-files/Ezh2/EZH2-trimmed.fastq /Volumes/My Passport/Hi-C/ChIP-seq-files/Ezh2/EZH2.sam"
    EZH2-SRR579282.1	4	*	0	0	*	*	0	0	TAGTTTGATTCACCCAAGGGTGAATGGGGGAACAAGAAAG	F>BACFHAHIEHFGII@FHGEE;9CFAHH)8??FFH;BDH	XM:i:0
    X¢˚˚p¢˚˚D@X¢˚˚p¢˚˚D@X¢˚˚p¢˚˚D@EZH2-SRR579282.5	4	*	0	0	*	*	0	0	GCTAAAACCATCCAGTGGAAGAAAAACAGCATTTTCAACA	HHHHIIIIIIHIIIHHHIEGHEGIIFIIGAGHIIGFGHII	XM:i:1
    I'm not quite sure what's going on here. I've had it happen with a couple of SAM files generated from SRA > Fastq, so I'm thinking it may be coming from the fastq-dump step.

    Any insight or help would be greatly appreciated,

    David

Latest Articles

Collapse

  • seqadmin
    Current Approaches to Protein Sequencing
    by seqadmin


    Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
    04-04-2024, 04:25 PM
  • seqadmin
    Strategies for Sequencing Challenging Samples
    by seqadmin


    Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
    03-22-2024, 06:39 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 04-11-2024, 12:08 PM
0 responses
34 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 10:19 PM
0 responses
37 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 09:21 AM
0 responses
31 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-04-2024, 09:00 AM
0 responses
53 views
0 likes
Last Post seqadmin  
Working...
X