Truncated File: Trouble with SRA > Fastq > Sam - SEQanswers

You are currently viewing the SEQanswers forums as a guest, which limits your access. Click here to register now, and join the discussion

SEQanswers June Challenge Has Begun!

The competition has begun! We're giving away a $50 Amazon gift card to the member who answers the most questions on our site during the month. We want to encourage our community members to share their knowledge and help each other out by answering questions related to sequencing technologies, genomics, and bioinformatics. The competition is open to all members of the site, and the winner will be announced at the beginning of July. Best of luck!

For a list of the official rules, visit (https://www.seqanswers.com/forum/sit...wledge-and-win)

See more

See less

X

DPCook

Member

Join Date: Sep 2014
Posts: 10

#1

Truncated File: Trouble with SRA > Fastq > Sam

12-10-2014, 10:49 AM

Hi everyone,

I know there have been several posts regarding truncated SAM files, but I'm having a difficult time finding a solution.

I've converted an SRA file to FASTQ with fastq-dump:

Code:

fastq-dump [SRA] [Output-prefix]

QC/Trimmed the FASTQ,

Bowtie to align (SAM output):

Code:

bowtie -n 2 -k 1 -l 40 --best -m 1 -S [genome] [FASTQ] [SAM output]

But when I try to convert sam to bam

Code:

$ samtools view -Sb [.SAM] > [.BAM]
[W::sam_read1] parse error at line 26
[main_samview] truncated file.

So I looked at line 26 and it does appear odd (bottom line):

Code:

@HD	VN:1.0	SO:unsorted
@SQ	SN:chr1	LN:197195432
@SQ	SN:chr2	LN:181748087
@SQ	SN:chr3	LN:159599783
@SQ	SN:chr4	LN:155630120
@SQ	SN:chr5	LN:152537259
@SQ	SN:chr6	LN:149517037
@SQ	SN:chr7	LN:152524553
@SQ	SN:chr8	LN:131738871
@SQ	SN:chr9	LN:124076172
@SQ	SN:chr10	LN:129993255
@SQ	SN:chr11	LN:121843856
@SQ	SN:chr12	LN:121257530
@SQ	SN:chr13	LN:120284312
@SQ	SN:chr14	LN:125194864
@SQ	SN:chr15	LN:103494974
@SQ	SN:chr16	LN:98319150
@SQ	SN:chr17	LN:95272651
@SQ	SN:chr18	LN:90772031
@SQ	SN:chr19	LN:61342430
@SQ	SN:chrX	LN:166650296
@SQ	SN:chrY	LN:15902555
@SQ	SN:chrM	LN:16299
@PG	ID:Bowtie	VN:1.1.1	CL:"bowtie --wrapper basic-0 -n 2 -k 1 -l 40 --best -m 1 -S /Users/DPC/Documents/Genome_Indexes/mm9.ebwt/mm9 /Volumes/My Passport/Hi-C/ChIP-seq-files/Ezh2/EZH2-trimmed.fastq /Volumes/My Passport/Hi-C/ChIP-seq-files/Ezh2/EZH2.sam"
EZH2-SRR579282.1	4	*	0	0	*	*	0	0	TAGTTTGATTCACCCAAGGGTGAATGGGGGAACAAGAAAG	F>[email protected];9CFAHH)8??FFH;BDH	XM:i:0
X¢˚˚p¢˚˚D@X¢˚˚p¢˚˚D@X¢˚˚p¢˚˚D@EZH2-SRR579282.5	4	*	0	0	*	*	0	0	GCTAAAACCATCCAGTGGAAGAAAAACAGCATTTTCAACA	HHHHIIIIIIHIIIHHHIEGHEGIIFIIGAGHIIGFGHII	XM:i:1

I'm not quite sure what's going on here. I've had it happen with a couple of SAM files generated from SRA > Fastq, so I'm thinking it may be coming from the fastq-dump step.

Any insight or help would be greatly appreciated,

David

Tags: fastq-dump, sam, sequencing, sra, truncated

Previous template Next

A Review of Next-Generation Sequencing Methods for Studying Epigenetics—Part 1

by seqadmin

Developments in sequencing technologies and methodologies have transformed the field of epigenetics, giving researchers a better way to understand the complex world of gene regulation and heritable modifications. This article explores some of the diverse sequencing methods employed in the study of epigenetics, ranging from classic techniques to cutting-edge innovations while providing a brief overview of their processes, applications, and advances.

Methylation Detect...
- Channel: Articles
05-31-2023, 10:46 AM
Differential Expression and Data Visualization: Recommended Tools for Next-Level Sequencing Analysis

by seqadmin

After covering QC and alignment tools in the first segment and variant analysis and genome assembly in the second segment, we’re wrapping up with a discussion about tools for differential gene expression analysis and data visualization. In this article, we include recommendations from the following experts: Dr. Mark Ziemann, Senior Lecturer in Biotechnology and Bioinformatics, Deakin University; Dr. Medhat Mahmoud Postdoctoral Research Fellow at Baylor College of Medicine;...
- Channel: Articles
05-23-2023, 12:26 PM
Variant Analysis and Genome Assembly: Recommended Tools for Next-Level Sequencing Analysis

by seqadmin

Continuing from our previous article, we share variant analysis and genome assembly tools recommended by our experts Dr. Medhat Mahmoud, Postdoctoral Research Fellow at Baylor College of Medicine, and Dr. Ming "Tommy" Tang, Director of Computational Biology at Immunitas and author of From Cell Line to Command Line.

Variant detection and analysis tools
Mahmoud classifies variant detection work into two main groups: short variants (<50...
- Channel: Articles
05-19-2023, 10:03 AM

	Topics		Statistics	Last Post
	Genetic Discoveries Transform Our Understanding of Primate Diversity and Behavior by seqadmin Started by seqadmin, Yesterday, 08:56 PM		0 responses 8 views 0 likes	Last Post by seqadmin Yesterday, 08:56 PM
	Deep Sequencing Unearths Novel Genetic Variants: Enhancing Precision Medicine for Vascular Anomalies by seqadmin Started by seqadmin, Yesterday, 07:33 AM		0 responses 8 views 0 likes	Last Post by seqadmin Yesterday, 07:33 AM
	Unveiling Genetic Associations Through Transcription Factor Binding Quantitative Trait Loci by seqadmin Started by seqadmin, 05-31-2023, 07:50 AM		0 responses 4 views 0 likes	Last Post by seqadmin 05-31-2023, 07:50 AM
	Exploring French-Canadian Ancestry: Insights into Migration, Settlement Patterns, and Genetic Structure by seqadmin Started by seqadmin, 05-26-2023, 09:22 AM		0 responses 9 views 0 likes	Last Post by seqadmin 05-26-2023, 09:22 AM

Working...

X