Bfast output and "Empty Sequence Dictionary" in .sam output

[aiden]

Hi there,
I've recently been struggling with the .sam output file from BFAST postprocess. My goal is to get this output into a .ace format. Anthony Fejes recently tweaked the ConvertToAce utility within the Vancouver Short Read Analysis Package to accept .sam input files. However, when the utility runs I get an output like this:

Line 950
Line: SRR026786.11209822        0       2010_05_14_New_Consensus_237-1  1130   255      23M4I9M *       0       0       TATCCACTGCACTCCACTCCACTGCCGCCGCTTCGT   IAIII;IFII+II>I)DAEI&>0+43$20*%2)*#"     PG:Z:bfast      AS:i:275        NM:i:9 NH:i:1   IH:i:1  HI:i:1  MD:Z:A7C14^GCCG1TA4A1   XA:i:3
Ignoring SAM validation error due to lenient parsing:
Error parsing text SAM file. Empty sequence dictionary.; File SRR026786_postprocess_nounmapped.sam;

When I used the ValidateSamFile utility from Picard to check my .sam file, I get an error output saying that all of the lines have an empty sequence dictionary.

The only processing that I've done to the .sam file between BFAST postprocess and the ConvertToAce utility is to remove unmapped reads using samtools view with the following options:

samtools view SRR026786_postprocess.sam -S -F 4 -o SRR026786_postprocess_nounmapped.sam

...Which makes me wonder why the Empty Sequence Dictionary error would occur unless there was some issue upstream in the work flow.

Has anyone else had any issues with Empty Sequence Dictionary in BFAST postprocess .sam output files? Can anyone think of a work around? I know that Picard has the CreateSequenceDictionary utility, but I'm not sure how I could use this to add a sequence dictionary to each aligned read in my .sam file.

Any ideas would be greatly appreciated.
Aiden

[nilshomer]

Hi there,
I've recently been struggling with the .sam output file from BFAST postprocess. My goal is to get this output into a .ace format. Anthony Fejes recently tweaked the ConvertToAce utility within the Vancouver Short Read Analysis Package to accept .sam input files. However, when the utility runs I get an output like this:

Line 950
Line: SRR026786.11209822        0       2010_05_14_New_Consensus_237-1  1130   255      23M4I9M *       0       0       TATCCACTGCACTCCACTCCACTGCCGCCGCTTCGT   IAIII;IFII+II>I)DAEI&>0+43$20*%2)*#"     PG:Z:bfast      AS:i:275        NM:i:9 NH:i:1   IH:i:1  HI:i:1  MD:Z:A7C14^GCCG1TA4A1   XA:i:3
Ignoring SAM validation error due to lenient parsing:
Error parsing text SAM file. Empty sequence dictionary.; File SRR026786_postprocess_nounmapped.sam;

When I used the ValidateSamFile utility from Picard to check my .sam file, I get an error output saying that all of the lines have an empty sequence dictionary.

The only processing that I've done to the .sam file between BFAST postprocess and the ConvertToAce utility is to remove unmapped reads using samtools view with the following options:

samtools view SRR026786_postprocess.sam -S -F 4 -o SRR026786_postprocess_nounmapped.sam

...Which makes me wonder why the Empty Sequence Dictionary error would occur unless there was some issue upstream in the work flow.

Has anyone else had any issues with Empty Sequence Dictionary in BFAST postprocess .sam output files? Can anyone think of a work around? I know that Picard has the CreateSequenceDictionary utility, but I'm not sure how I could use this to add a sequence dictionary to each aligned read in my .sam file.

Any ideas would be greatly appreciated.
Aiden

Use the "-h" option with samtools view, otherwise the SAM header (with the sequence dictionary) will not be outputted by "samtools view".